Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624328_a_at:

>probe:Drosophila_2:1624328_a_at:158:171; Interrogation_Position=124; Antisense; AAAGGGCTTTTCCAGCATCGAGACG
>probe:Drosophila_2:1624328_a_at:370:203; Interrogation_Position=179; Antisense; AACCAGGTGCATCGAAAGTCCGTGA
>probe:Drosophila_2:1624328_a_at:717:81; Interrogation_Position=207; Antisense; AGGGATTCGAGTTCACCCTAATGGT
>probe:Drosophila_2:1624328_a_at:400:135; Interrogation_Position=260; Antisense; ACGCTGGTCAATAGTCTCTTTCTCA
>probe:Drosophila_2:1624328_a_at:72:453; Interrogation_Position=287; Antisense; GATCTCTATCCCGAGCGCATTATTC
>probe:Drosophila_2:1624328_a_at:694:297; Interrogation_Position=302; Antisense; CGCATTATTCCGGACGCCATAGAGA
>probe:Drosophila_2:1624328_a_at:45:175; Interrogation_Position=336; Antisense; AAACCGTAAAGCTGGAGGCATCGAC
>probe:Drosophila_2:1624328_a_at:411:75; Interrogation_Position=372; Antisense; AGGAGCGCGGCGTCAAGCTAAGATT
>probe:Drosophila_2:1624328_a_at:171:341; Interrogation_Position=447; Antisense; GCTTTGGTGCCATACTCGAGTACAT
>probe:Drosophila_2:1624328_a_at:5:445; Interrogation_Position=473; Antisense; GATGAGCAATACGAGCGCTTCCTGC
>probe:Drosophila_2:1624328_a_at:252:287; Interrogation_Position=508; Antisense; CGGCCTGAACAGACGCAACATTGTG
>probe:Drosophila_2:1624328_a_at:115:521; Interrogation_Position=530; Antisense; GTGGACAATCGCATTCACTGCTGTT
>probe:Drosophila_2:1624328_a_at:527:601; Interrogation_Position=551; Antisense; TGTTTCTACTTTATATCGCCGTTCG
>probe:Drosophila_2:1624328_a_at:601:471; Interrogation_Position=65; Antisense; GTTCGTCATTACGTTGATTTCTTCG

Paste this into a BLAST search page for me
AAAGGGCTTTTCCAGCATCGAGACGAACCAGGTGCATCGAAAGTCCGTGAAGGGATTCGAGTTCACCCTAATGGTACGCTGGTCAATAGTCTCTTTCTCAGATCTCTATCCCGAGCGCATTATTCCGCATTATTCCGGACGCCATAGAGAAAACCGTAAAGCTGGAGGCATCGACAGGAGCGCGGCGTCAAGCTAAGATTGCTTTGGTGCCATACTCGAGTACATGATGAGCAATACGAGCGCTTCCTGCCGGCCTGAACAGACGCAACATTGTGGTGGACAATCGCATTCACTGCTGTTTGTTTCTACTTTATATCGCCGTTCGGTTCGTCATTACGTTGATTTCTTCG

Full Affymetrix probeset data:

Annotations for 1624328_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime