FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624329_at:

>probe:Drosophila_2:1624329_at:328:209; Interrogation_Position=1782; Antisense; AAGAACAAGACCTGCATGATTGCCA
>probe:Drosophila_2:1624329_at:589:603; Interrogation_Position=1798; Antisense; TGATTGCCATGATATCGCCATCCAT
>probe:Drosophila_2:1624329_at:656:313; Interrogation_Position=1814; Antisense; GCCATCCATGAGCTGCGTGGAGAAT
>probe:Drosophila_2:1624329_at:234:421; Interrogation_Position=1833; Antisense; GAGAATACGCTCAACACTCTACGTT
>probe:Drosophila_2:1624329_at:241:641; Interrogation_Position=1850; Antisense; TCTACGTTACGCAGACAGGGTTAAG
>probe:Drosophila_2:1624329_at:166:103; Interrogation_Position=1892; Antisense; AGACGAACACTTGCAGTCCGTGGAA
>probe:Drosophila_2:1624329_at:482:373; Interrogation_Position=1928; Antisense; GAAGTCTCCCGATCTCAACGAGGAA
>probe:Drosophila_2:1624329_at:2:117; Interrogation_Position=2014; Antisense; AGCATCTAACCATATCCTCGGAGGA
>probe:Drosophila_2:1624329_at:705:547; Interrogation_Position=2036; Antisense; GGAGGCAAGCTCCTACAACAACATG
>probe:Drosophila_2:1624329_at:629:53; Interrogation_Position=2065; Antisense; ATGACATGAGCTTTAACCACACCCT
>probe:Drosophila_2:1624329_at:612:591; Interrogation_Position=2095; Antisense; TTCTGGGTCCCTCAAGGAACGTGGA
>probe:Drosophila_2:1624329_at:321:295; Interrogation_Position=2135; Antisense; CGAGCAGCACGCACTTTTGGTAGAG
>probe:Drosophila_2:1624329_at:160:423; Interrogation_Position=2157; Antisense; GAGAATCTAGAGACTTACGCTCACA
>probe:Drosophila_2:1624329_at:95:673; Interrogation_Position=2172; Antisense; TACGCTCACAATTTCCGGCAACTGA

Paste this into a BLAST search page for me
AAGAACAAGACCTGCATGATTGCCATGATTGCCATGATATCGCCATCCATGCCATCCATGAGCTGCGTGGAGAATGAGAATACGCTCAACACTCTACGTTTCTACGTTACGCAGACAGGGTTAAGAGACGAACACTTGCAGTCCGTGGAAGAAGTCTCCCGATCTCAACGAGGAAAGCATCTAACCATATCCTCGGAGGAGGAGGCAAGCTCCTACAACAACATGATGACATGAGCTTTAACCACACCCTTTCTGGGTCCCTCAAGGAACGTGGACGAGCAGCACGCACTTTTGGTAGAGGAGAATCTAGAGACTTACGCTCACATACGCTCACAATTTCCGGCAACTGA

Full Affymetrix probeset data:

Annotations for 1624329_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720