Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624331_at:

>probe:Drosophila_2:1624331_at:676:73; Interrogation_Position=354; Antisense; AGGAAAACATCGAGCGTTCCCGCAT
>probe:Drosophila_2:1624331_at:300:585; Interrogation_Position=435; Antisense; TGGACATGGTCAACTACCTTCTCAA
>probe:Drosophila_2:1624331_at:680:191; Interrogation_Position=458; Antisense; AACTTCATCGCCACAGACACGGTGC
>probe:Drosophila_2:1624331_at:684:157; Interrogation_Position=474; Antisense; ACACGGTGCTCTTCCAGTACGATGA
>probe:Drosophila_2:1624331_at:357:227; Interrogation_Position=531; Antisense; AATGGGACCCGGTGATCGCCTGGTT
>probe:Drosophila_2:1624331_at:98:325; Interrogation_Position=562; Antisense; GCGCTACGACACAAACCTGCAGAAG
>probe:Drosophila_2:1624331_at:106:501; Interrogation_Position=635; Antisense; GTCGCAAAGCATTTTCAGTCCTACA
>probe:Drosophila_2:1624331_at:534:479; Interrogation_Position=660; Antisense; GTTTGGAAACTCTGCATGGCTTCAT
>probe:Drosophila_2:1624331_at:290:67; Interrogation_Position=675; Antisense; ATGGCTTCATTTTCGCTGTGGACAC
>probe:Drosophila_2:1624331_at:126:707; Interrogation_Position=701; Antisense; TTAAAGTCGATTGTCCTTGCCTGCG
>probe:Drosophila_2:1624331_at:438:623; Interrogation_Position=722; Antisense; TGCGCCGTCATCGAGCAGATGCTTA
>probe:Drosophila_2:1624331_at:474:705; Interrogation_Position=744; Antisense; TTACCGTGGAGAAGGCTGTGGCCCT
>probe:Drosophila_2:1624331_at:615:153; Interrogation_Position=838; Antisense; ACAGGAGTTGCAAGCACGCCTGGCG
>probe:Drosophila_2:1624331_at:629:641; Interrogation_Position=873; Antisense; TCTTCGTACACCTTAACTGTTCGGA

Paste this into a BLAST search page for me
AGGAAAACATCGAGCGTTCCCGCATTGGACATGGTCAACTACCTTCTCAAAACTTCATCGCCACAGACACGGTGCACACGGTGCTCTTCCAGTACGATGAAATGGGACCCGGTGATCGCCTGGTTGCGCTACGACACAAACCTGCAGAAGGTCGCAAAGCATTTTCAGTCCTACAGTTTGGAAACTCTGCATGGCTTCATATGGCTTCATTTTCGCTGTGGACACTTAAAGTCGATTGTCCTTGCCTGCGTGCGCCGTCATCGAGCAGATGCTTATTACCGTGGAGAAGGCTGTGGCCCTACAGGAGTTGCAAGCACGCCTGGCGTCTTCGTACACCTTAACTGTTCGGA

Full Affymetrix probeset data:

Annotations for 1624331_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime