Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624332_s_at:

>probe:Drosophila_2:1624332_s_at:685:95; Interrogation_Position=466; Antisense; AGATCCAATCGTCACGCGCTGGAAG
>probe:Drosophila_2:1624332_s_at:217:221; Interrogation_Position=501; Antisense; AAGGAGCAATTGTGGCCAACCCGAC
>probe:Drosophila_2:1624332_s_at:339:99; Interrogation_Position=546; Antisense; AGATGGTTGCCATACAGCGGTCCGA
>probe:Drosophila_2:1624332_s_at:415:397; Interrogation_Position=569; Antisense; GACAACAAGTTGTGGGCCATTCCCG
>probe:Drosophila_2:1624332_s_at:533:9; Interrogation_Position=587; Antisense; ATTCCCGGTGGAATGGTCGATCCCG
>probe:Drosophila_2:1624332_s_at:713:449; Interrogation_Position=605; Antisense; GATCCCGGCGAGAATGTCAGTGTCA
>probe:Drosophila_2:1624332_s_at:196:647; Interrogation_Position=621; Antisense; TCAGTGTCACCCTTAAGCGGGAGTT
>probe:Drosophila_2:1624332_s_at:192:121; Interrogation_Position=703; Antisense; AGCGGGAGGCGTTCAGGTATACCAA
>probe:Drosophila_2:1624332_s_at:11:549; Interrogation_Position=765; Antisense; GGATGGAAACCACTGCGCTGAACTT
>probe:Drosophila_2:1624332_s_at:728:655; Interrogation_Position=828; Antisense; TAATGGCCGGTGACGATGCCTCCAA
>probe:Drosophila_2:1624332_s_at:730:49; Interrogation_Position=843; Antisense; ATGCCTCCAATGTGCGCTGGACGGA
>probe:Drosophila_2:1624332_s_at:449:139; Interrogation_Position=867; Antisense; ACGTCGACTCGAATCTCAAGCTGCA
>probe:Drosophila_2:1624332_s_at:601:237; Interrogation_Position=896; Antisense; AATCATGCCGACATAGTCCGTGAGG
>probe:Drosophila_2:1624332_s_at:20:503; Interrogation_Position=911; Antisense; GTCCGTGAGGTTGTCATCCGACGAA

Paste this into a BLAST search page for me
AGATCCAATCGTCACGCGCTGGAAGAAGGAGCAATTGTGGCCAACCCGACAGATGGTTGCCATACAGCGGTCCGAGACAACAAGTTGTGGGCCATTCCCGATTCCCGGTGGAATGGTCGATCCCGGATCCCGGCGAGAATGTCAGTGTCATCAGTGTCACCCTTAAGCGGGAGTTAGCGGGAGGCGTTCAGGTATACCAAGGATGGAAACCACTGCGCTGAACTTTAATGGCCGGTGACGATGCCTCCAAATGCCTCCAATGTGCGCTGGACGGAACGTCGACTCGAATCTCAAGCTGCAAATCATGCCGACATAGTCCGTGAGGGTCCGTGAGGTTGTCATCCGACGAA

Full Affymetrix probeset data:

Annotations for 1624332_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime