FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624333_at:

>probe:Drosophila_2:1624333_at:307:711; Interrogation_Position=1021; Antisense; TTCTACGAGTTCACCTGGCAGATTC
>probe:Drosophila_2:1624333_at:219:95; Interrogation_Position=1040; Antisense; AGATTCTTGTAGCTGCCGTATGTCT
>probe:Drosophila_2:1624333_at:701:683; Interrogation_Position=1082; Antisense; TATCCACTTATCTGCTGTCCAAGAT
>probe:Drosophila_2:1624333_at:192:411; Interrogation_Position=1126; Antisense; GACGCACTAACTTTGGCCATCGAGG
>probe:Drosophila_2:1624333_at:51:387; Interrogation_Position=1161; Antisense; GAACATGACCATGCCCATTGTGCTG
>probe:Drosophila_2:1624333_at:87:275; Interrogation_Position=1176; Antisense; CATTGTGCTGCTGCAATCCAGTCAG
>probe:Drosophila_2:1624333_at:704:503; Interrogation_Position=1273; Antisense; GTCCTGTTCTATGGCATTCGACGAT
>probe:Drosophila_2:1624333_at:672:267; Interrogation_Position=1318; Antisense; CAGGATGCGGATGCCTTTGATCACA
>probe:Drosophila_2:1624333_at:501:315; Interrogation_Position=778; Antisense; GCCTTGCTGCCCATTTGGATATTGG
>probe:Drosophila_2:1624333_at:339:715; Interrogation_Position=803; Antisense; TTCTGGGCCGGATACTCTACGAGGA
>probe:Drosophila_2:1624333_at:430:55; Interrogation_Position=830; Antisense; ATGAGCTAACAGTGCCGTTTGGCCA
>probe:Drosophila_2:1624333_at:410:691; Interrogation_Position=847; Antisense; TTTGGCCAGCTTTCCGGAGGAGCAG
>probe:Drosophila_2:1624333_at:335:553; Interrogation_Position=926; Antisense; GGACCACTAGGTTCATCTTTCGCTT
>probe:Drosophila_2:1624333_at:387:137; Interrogation_Position=995; Antisense; TGACGGTGGGTCTCAACTCGTTCGT

Paste this into a BLAST search page for me
TTCTACGAGTTCACCTGGCAGATTCAGATTCTTGTAGCTGCCGTATGTCTTATCCACTTATCTGCTGTCCAAGATGACGCACTAACTTTGGCCATCGAGGGAACATGACCATGCCCATTGTGCTGCATTGTGCTGCTGCAATCCAGTCAGGTCCTGTTCTATGGCATTCGACGATCAGGATGCGGATGCCTTTGATCACAGCCTTGCTGCCCATTTGGATATTGGTTCTGGGCCGGATACTCTACGAGGAATGAGCTAACAGTGCCGTTTGGCCATTTGGCCAGCTTTCCGGAGGAGCAGGGACCACTAGGTTCATCTTTCGCTTTGACGGTGGGTCTCAACTCGTTCGT

Full Affymetrix probeset data:

Annotations for 1624333_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720