FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624334_at:

>probe:Drosophila_2:1624334_at:543:419; Interrogation_Position=122; Antisense; GAGCAGAATACCACATACCAAGCGT
>probe:Drosophila_2:1624334_at:609:25; Interrogation_Position=136; Antisense; ATACCAAGCGTAAGACAATCCATAA
>probe:Drosophila_2:1624334_at:470:725; Interrogation_Position=163; Antisense; TTGAGTTCCATTGGATCCACGCGAC
>probe:Drosophila_2:1624334_at:457:165; Interrogation_Position=196; Antisense; AAATCGGAGCCAACTAATGTCCCGG
>probe:Drosophila_2:1624334_at:311:9; Interrogation_Position=223; Antisense; ATTCCCGATCGTTCTATCAATTGCG
>probe:Drosophila_2:1624334_at:427:43; Interrogation_Position=230; Antisense; ATCGTTCTATCAATTGCGGCGCCTA
>probe:Drosophila_2:1624334_at:424:7; Interrogation_Position=242; Antisense; ATTGCGGCGCCTATGAGAAATTTCA
>probe:Drosophila_2:1624334_at:371:609; Interrogation_Position=255; Antisense; TGAGAAATTTCAGCACGTCCCAACA
>probe:Drosophila_2:1624334_at:155:351; Interrogation_Position=267; Antisense; GCACGTCCCAACACAAATTAGCAGA
>probe:Drosophila_2:1624334_at:361:353; Interrogation_Position=301; Antisense; GCAGCGCCCCATAACAATATCATAA
>probe:Drosophila_2:1624334_at:146:351; Interrogation_Position=34; Antisense; GCAGAATGGACTTGGATCCGACCCT
>probe:Drosophila_2:1624334_at:671:45; Interrogation_Position=49; Antisense; ATCCGACCCTCTGTCAGCAAAGGAG
>probe:Drosophila_2:1624334_at:558:647; Interrogation_Position=62; Antisense; TCAGCAAAGGAGTCCGTCCCATCAG
>probe:Drosophila_2:1624334_at:570:501; Interrogation_Position=86; Antisense; GTCGCCTCAAAGCAAAAGCCGTCAG

Paste this into a BLAST search page for me
GAGCAGAATACCACATACCAAGCGTATACCAAGCGTAAGACAATCCATAATTGAGTTCCATTGGATCCACGCGACAAATCGGAGCCAACTAATGTCCCGGATTCCCGATCGTTCTATCAATTGCGATCGTTCTATCAATTGCGGCGCCTAATTGCGGCGCCTATGAGAAATTTCATGAGAAATTTCAGCACGTCCCAACAGCACGTCCCAACACAAATTAGCAGAGCAGCGCCCCATAACAATATCATAAGCAGAATGGACTTGGATCCGACCCTATCCGACCCTCTGTCAGCAAAGGAGTCAGCAAAGGAGTCCGTCCCATCAGGTCGCCTCAAAGCAAAAGCCGTCAG

Full Affymetrix probeset data:

Annotations for 1624334_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720