Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624335_at:

>probe:Drosophila_2:1624335_at:301:415; Interrogation_Position=1127; Antisense; GAGCGGGTGTCAAACGCAAGTCCTT
>probe:Drosophila_2:1624335_at:168:77; Interrogation_Position=1154; Antisense; AGGAGGACTACGACATCATCAAAAA
>probe:Drosophila_2:1624335_at:202:181; Interrogation_Position=1174; Antisense; AAAAAGATCGGCAGCGCCCTGGCGA
>probe:Drosophila_2:1624335_at:509:439; Interrogation_Position=1204; Antisense; GAGGCGCTCGTGGAAAAGTCCCAGA
>probe:Drosophila_2:1624335_at:510:103; Interrogation_Position=1226; Antisense; AGACCCCAAAGAACAGCCAGGCGGA
>probe:Drosophila_2:1624335_at:297:181; Interrogation_Position=1259; Antisense; AAAACACGCCCGTGCAGCGATTGAA
>probe:Drosophila_2:1624335_at:444:377; Interrogation_Position=1281; Antisense; GAAGCACATCTACGACGACAGCGAT
>probe:Drosophila_2:1624335_at:555:119; Interrogation_Position=1319; Antisense; AGCTGCGGGAGCTCATCGAGTACAA
>probe:Drosophila_2:1624335_at:711:269; Interrogation_Position=1362; Antisense; CATGAGCGAGATTACCAAGCAGTTC
>probe:Drosophila_2:1624335_at:492:173; Interrogation_Position=1452; Antisense; AAAGCTGCGATACGTGGTGCACAAC
>probe:Drosophila_2:1624335_at:347:535; Interrogation_Position=1467; Antisense; GGTGCACAACAAGCTCATCAACTTC
>probe:Drosophila_2:1624335_at:419:647; Interrogation_Position=1481; Antisense; TCATCAACTTCATGGCGCCCAATGA
>probe:Drosophila_2:1624335_at:381:487; Interrogation_Position=1508; Antisense; GTAGCGACTGGACGGATGCCTCCAA
>probe:Drosophila_2:1624335_at:241:49; Interrogation_Position=1523; Antisense; ATGCCTCCAAGTCCGAGTTGTACAA

Paste this into a BLAST search page for me
GAGCGGGTGTCAAACGCAAGTCCTTAGGAGGACTACGACATCATCAAAAAAAAAAGATCGGCAGCGCCCTGGCGAGAGGCGCTCGTGGAAAAGTCCCAGAAGACCCCAAAGAACAGCCAGGCGGAAAAACACGCCCGTGCAGCGATTGAAGAAGCACATCTACGACGACAGCGATAGCTGCGGGAGCTCATCGAGTACAACATGAGCGAGATTACCAAGCAGTTCAAAGCTGCGATACGTGGTGCACAACGGTGCACAACAAGCTCATCAACTTCTCATCAACTTCATGGCGCCCAATGAGTAGCGACTGGACGGATGCCTCCAAATGCCTCCAAGTCCGAGTTGTACAA

Full Affymetrix probeset data:

Annotations for 1624335_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime