FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624337_at:

>probe:Drosophila_2:1624337_at:311:635; Interrogation_Position=20; Antisense; TCGCATCCGGCGCACGCAATTGTTG
>probe:Drosophila_2:1624337_at:57:297; Interrogation_Position=34; Antisense; CGCAATTGTTGCTGATCGACGACCA
>probe:Drosophila_2:1624337_at:478:725; Interrogation_Position=39; Antisense; TTGTTGCTGATCGACGACCAGACTC
>probe:Drosophila_2:1624337_at:366:451; Interrogation_Position=47; Antisense; GATCGACGACCAGACTCTGCAGAAT
>probe:Drosophila_2:1624337_at:484:501; Interrogation_Position=512; Antisense; GTCGTCGTCTGTAGAAATGGATCGT
>probe:Drosophila_2:1624337_at:323:483; Interrogation_Position=522; Antisense; GTAGAAATGGATCGTGCCACCCGCT
>probe:Drosophila_2:1624337_at:396:229; Interrogation_Position=527; Antisense; AATGGATCGTGCCACCCGCTTTTGA
>probe:Drosophila_2:1624337_at:6:415; Interrogation_Position=54; Antisense; GACCAGACTCTGCAGAATGGCTCCA
>probe:Drosophila_2:1624337_at:196:133; Interrogation_Position=540; Antisense; ACCCGCTTTTGACGCTGCTTTATAT
>probe:Drosophila_2:1624337_at:197:343; Interrogation_Position=544; Antisense; GCTTTTGACGCTGCTTTATATTCTT
>probe:Drosophila_2:1624337_at:4:411; Interrogation_Position=550; Antisense; GACGCTGCTTTATATTCTTATACTA
>probe:Drosophila_2:1624337_at:297:105; Interrogation_Position=58; Antisense; AGACTCTGCAGAATGGCTCCAAGAA
>probe:Drosophila_2:1624337_at:519:53; Interrogation_Position=583; Antisense; ATGCATAAATGCAGTGGCAAGGGCA
>probe:Drosophila_2:1624337_at:605:581; Interrogation_Position=71; Antisense; TGGCTCCAAGAAAGGCTAAAGTTCA

Paste this into a BLAST search page for me
TCGCATCCGGCGCACGCAATTGTTGCGCAATTGTTGCTGATCGACGACCATTGTTGCTGATCGACGACCAGACTCGATCGACGACCAGACTCTGCAGAATGTCGTCGTCTGTAGAAATGGATCGTGTAGAAATGGATCGTGCCACCCGCTAATGGATCGTGCCACCCGCTTTTGAGACCAGACTCTGCAGAATGGCTCCAACCCGCTTTTGACGCTGCTTTATATGCTTTTGACGCTGCTTTATATTCTTGACGCTGCTTTATATTCTTATACTAAGACTCTGCAGAATGGCTCCAAGAAATGCATAAATGCAGTGGCAAGGGCATGGCTCCAAGAAAGGCTAAAGTTCA

Full Affymetrix probeset data:

Annotations for 1624337_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720