FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624338_at:

>probe:Drosophila_2:1624338_at:32:105; Interrogation_Position=200; Antisense; AGACTGCCTGAAGTTCTCGGATTTC
>probe:Drosophila_2:1624338_at:118:543; Interrogation_Position=218; Antisense; GGATTTCATCCTCCGGAACATGGAT
>probe:Drosophila_2:1624338_at:348:543; Interrogation_Position=261; Antisense; GGATACGACTTAACCGTTCGCGGAG
>probe:Drosophila_2:1624338_at:416:417; Interrogation_Position=283; Antisense; GAGCGGTGCACTTCATCCGGAGGCA
>probe:Drosophila_2:1624338_at:724:345; Interrogation_Position=305; Antisense; GCATTTGTCCGCCTATTTGAAGAGC
>probe:Drosophila_2:1624338_at:400:101; Interrogation_Position=325; Antisense; AGAGCGATTGCACGTTCCAGGTGTC
>probe:Drosophila_2:1624338_at:191:573; Interrogation_Position=360; Antisense; GGCGGATACGATTTGACCAGCGGTC
>probe:Drosophila_2:1624338_at:342:503; Interrogation_Position=382; Antisense; GTCCCGAGTTGCACTACATCGATTA
>probe:Drosophila_2:1624338_at:166:203; Interrogation_Position=490; Antisense; AACCGGACATGGATACGCAGGCAGC
>probe:Drosophila_2:1624338_at:489:297; Interrogation_Position=505; Antisense; CGCAGGCAGCCTATGATGTTATCAA
>probe:Drosophila_2:1624338_at:709:323; Interrogation_Position=572; Antisense; GCGCAACATAGATTTGTTCCTGATA
>probe:Drosophila_2:1624338_at:413:365; Interrogation_Position=620; Antisense; GAATAGCATCAACCTGGAGTCCCTT
>probe:Drosophila_2:1624338_at:441:543; Interrogation_Position=650; Antisense; GGATATCTTAGCTGGTCCCAAGCGA
>probe:Drosophila_2:1624338_at:668:631; Interrogation_Position=699; Antisense; TCGAAGCCCTTTATATTTTTTGTAG

Paste this into a BLAST search page for me
AGACTGCCTGAAGTTCTCGGATTTCGGATTTCATCCTCCGGAACATGGATGGATACGACTTAACCGTTCGCGGAGGAGCGGTGCACTTCATCCGGAGGCAGCATTTGTCCGCCTATTTGAAGAGCAGAGCGATTGCACGTTCCAGGTGTCGGCGGATACGATTTGACCAGCGGTCGTCCCGAGTTGCACTACATCGATTAAACCGGACATGGATACGCAGGCAGCCGCAGGCAGCCTATGATGTTATCAAGCGCAACATAGATTTGTTCCTGATAGAATAGCATCAACCTGGAGTCCCTTGGATATCTTAGCTGGTCCCAAGCGATCGAAGCCCTTTATATTTTTTGTAG

Full Affymetrix probeset data:

Annotations for 1624338_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720