Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624339_at:

>probe:Drosophila_2:1624339_at:637:447; Interrogation_Position=1577; Antisense; GATGCCTCGATTTTGGATAAGCCCA
>probe:Drosophila_2:1624339_at:451:203; Interrogation_Position=1595; Antisense; AAGCCCAAGAAGAGCTCCATCTTTG
>probe:Drosophila_2:1624339_at:543:351; Interrogation_Position=1642; Antisense; GCAGCAGGCCAAATCAACCTACGGA
>probe:Drosophila_2:1624339_at:507:721; Interrogation_Position=1670; Antisense; TTCCAAGTGGAGCTGTGGCGTCTTC
>probe:Drosophila_2:1624339_at:125:449; Interrogation_Position=1721; Antisense; GATGCCATCAACTCGTCGGAGAGCA
>probe:Drosophila_2:1624339_at:100:113; Interrogation_Position=1742; Antisense; AGCACGATATCTGGAGACCTGACCC
>probe:Drosophila_2:1624339_at:554:649; Interrogation_Position=1834; Antisense; TCAAAACCTGTCCACCTTTAAGATG
>probe:Drosophila_2:1624339_at:370:657; Interrogation_Position=1852; Antisense; TAAGATGGCCTCCAATCTGGTGGTT
>probe:Drosophila_2:1624339_at:584:637; Interrogation_Position=1867; Antisense; TCTGGTGGTTTTGCTTCACGCGGAC
>probe:Drosophila_2:1624339_at:580:405; Interrogation_Position=1926; Antisense; GACTGCCGAGTGTCCTGCCAGGAGT
>probe:Drosophila_2:1624339_at:128:269; Interrogation_Position=1944; Antisense; CAGGAGTTCCTCTACGGGTGGACTT
>probe:Drosophila_2:1624339_at:454:521; Interrogation_Position=1976; Antisense; GTGGCGGTATTGGATCCCATGGACA
>probe:Drosophila_2:1624339_at:473:635; Interrogation_Position=2033; Antisense; TCGCTGATCCGGGTTATGCTGATGA
>probe:Drosophila_2:1624339_at:407:683; Interrogation_Position=2047; Antisense; TATGCTGATGAAGGCCGGCCAGGCC

Paste this into a BLAST search page for me
GATGCCTCGATTTTGGATAAGCCCAAAGCCCAAGAAGAGCTCCATCTTTGGCAGCAGGCCAAATCAACCTACGGATTCCAAGTGGAGCTGTGGCGTCTTCGATGCCATCAACTCGTCGGAGAGCAAGCACGATATCTGGAGACCTGACCCTCAAAACCTGTCCACCTTTAAGATGTAAGATGGCCTCCAATCTGGTGGTTTCTGGTGGTTTTGCTTCACGCGGACGACTGCCGAGTGTCCTGCCAGGAGTCAGGAGTTCCTCTACGGGTGGACTTGTGGCGGTATTGGATCCCATGGACATCGCTGATCCGGGTTATGCTGATGATATGCTGATGAAGGCCGGCCAGGCC

Full Affymetrix probeset data:

Annotations for 1624339_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime