FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624342_at:

>probe:Drosophila_2:1624342_at:673:603; Interrogation_Position=1000; Antisense; TGATTCCTCATCTGTTTCCACGGAA
>probe:Drosophila_2:1624342_at:64:435; Interrogation_Position=1061; Antisense; GAGGAGGACTTGAAATCCCTCTCCT
>probe:Drosophila_2:1624342_at:419:155; Interrogation_Position=1092; Antisense; ACAGCAATGACCTCCAGAAGATTCT
>probe:Drosophila_2:1624342_at:69:3; Interrogation_Position=1143; Antisense; ATCACTAAGCGATCGTTTTAATTTT
>probe:Drosophila_2:1624342_at:159:247; Interrogation_Position=637; Antisense; AATTCCATCGGAATCCACAAGCACC
>probe:Drosophila_2:1624342_at:257:629; Interrogation_Position=671; Antisense; TCCACGGATTCTTCGACTGATTCGA
>probe:Drosophila_2:1624342_at:633:37; Interrogation_Position=778; Antisense; ATCTTCTACTGATTCCTCGACTGAT
>probe:Drosophila_2:1624342_at:345:237; Interrogation_Position=822; Antisense; AATCGTCTACTGATTCGTCCTCCGT
>probe:Drosophila_2:1624342_at:419:497; Interrogation_Position=845; Antisense; GTCTCCACTGAATCCTCAACGGATT
>probe:Drosophila_2:1624342_at:412:197; Interrogation_Position=862; Antisense; AACGGATTCCTCAACTGATTCGTCC
>probe:Drosophila_2:1624342_at:148:517; Interrogation_Position=890; Antisense; GTGTCCACCGAATCATCCACTGATT
>probe:Drosophila_2:1624342_at:68:143; Interrogation_Position=908; Antisense; ACTGATTCGTCGACAGACTCCTCAT
>probe:Drosophila_2:1624342_at:341:235; Interrogation_Position=945; Antisense; AATCCTCTACTGAATCCTCGTCTGA
>probe:Drosophila_2:1624342_at:575:673; Interrogation_Position=985; Antisense; TACCGAATCCTCTACTGATTCCTCA

Paste this into a BLAST search page for me
TGATTCCTCATCTGTTTCCACGGAAGAGGAGGACTTGAAATCCCTCTCCTACAGCAATGACCTCCAGAAGATTCTATCACTAAGCGATCGTTTTAATTTTAATTCCATCGGAATCCACAAGCACCTCCACGGATTCTTCGACTGATTCGAATCTTCTACTGATTCCTCGACTGATAATCGTCTACTGATTCGTCCTCCGTGTCTCCACTGAATCCTCAACGGATTAACGGATTCCTCAACTGATTCGTCCGTGTCCACCGAATCATCCACTGATTACTGATTCGTCGACAGACTCCTCATAATCCTCTACTGAATCCTCGTCTGATACCGAATCCTCTACTGATTCCTCA

Full Affymetrix probeset data:

Annotations for 1624342_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720