Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624343_at:

>probe:Drosophila_2:1624343_at:428:707; Interrogation_Position=1185; Antisense; TTAAATCGCACCAAGTGTACTCCCA
>probe:Drosophila_2:1624343_at:660:47; Interrogation_Position=1220; Antisense; ATCCACAGCTCCGAACGACAGTTTT
>probe:Drosophila_2:1624343_at:184:401; Interrogation_Position=1236; Antisense; GACAGTTTTCATGCGATGCGTGCCC
>probe:Drosophila_2:1624343_at:507:199; Interrogation_Position=1313; Antisense; AAGCCTTACCGGTGTGCCGTGTGCA
>probe:Drosophila_2:1624343_at:447:15; Interrogation_Position=1345; Antisense; ATTTTCTTCGATGTACGCCGTCAAG
>probe:Drosophila_2:1624343_at:139:489; Interrogation_Position=1357; Antisense; GTACGCCGTCAAGAATCACATGCAG
>probe:Drosophila_2:1624343_at:198:357; Interrogation_Position=1401; Antisense; GCAAAGGAAGTGTCGGCTCTGGTAC
>probe:Drosophila_2:1624343_at:379:191; Interrogation_Position=1430; Antisense; AACATTAAGAGTGCGGCCACCTCGA
>probe:Drosophila_2:1624343_at:647:729; Interrogation_Position=1489; Antisense; TTGTGGAGCTGAGTACGCACGTCTC
>probe:Drosophila_2:1624343_at:307:153; Interrogation_Position=1530; Antisense; ACATGAAGTCGGCTCACGGTTTGGT
>probe:Drosophila_2:1624343_at:518:143; Interrogation_Position=1583; Antisense; ACTGATGCTGCACACGTCGCTGAGA
>probe:Drosophila_2:1624343_at:704:447; Interrogation_Position=1652; Antisense; GATGCCGCTTACATAAACGCTGTGG
>probe:Drosophila_2:1624343_at:210:443; Interrogation_Position=1682; Antisense; GATGTAGACATCGTGGGCACCGTAC
>probe:Drosophila_2:1624343_at:225:487; Interrogation_Position=1703; Antisense; GTACCCACCTACGAAGAGTGCGTTG

Paste this into a BLAST search page for me
TTAAATCGCACCAAGTGTACTCCCAATCCACAGCTCCGAACGACAGTTTTGACAGTTTTCATGCGATGCGTGCCCAAGCCTTACCGGTGTGCCGTGTGCAATTTTCTTCGATGTACGCCGTCAAGGTACGCCGTCAAGAATCACATGCAGGCAAAGGAAGTGTCGGCTCTGGTACAACATTAAGAGTGCGGCCACCTCGATTGTGGAGCTGAGTACGCACGTCTCACATGAAGTCGGCTCACGGTTTGGTACTGATGCTGCACACGTCGCTGAGAGATGCCGCTTACATAAACGCTGTGGGATGTAGACATCGTGGGCACCGTACGTACCCACCTACGAAGAGTGCGTTG

Full Affymetrix probeset data:

Annotations for 1624343_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime