FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624352_at:

>probe:Drosophila_2:1624352_at:636:571; Interrogation_Position=114; Antisense; GGCTAGCGAGCCATCAGTGAGGCAT
>probe:Drosophila_2:1624352_at:612:505; Interrogation_Position=190; Antisense; GTGCCACAGCCGTATGCCCAAAGTG
>probe:Drosophila_2:1624352_at:121:117; Interrogation_Position=244; Antisense; AGCTTCGACTCGACCAATGTGATCG
>probe:Drosophila_2:1624352_at:511:513; Interrogation_Position=262; Antisense; GTGATCGATGGCCAAAGCCAGCCGA
>probe:Drosophila_2:1624352_at:337:73; Interrogation_Position=302; Antisense; AGGAAGCGGTGCTCCAGACGCATTC
>probe:Drosophila_2:1624352_at:131:89; Interrogation_Position=329; Antisense; ACTCCCGGATCCAGGCCAAAGATAC
>probe:Drosophila_2:1624352_at:513:667; Interrogation_Position=377; Antisense; TACATCGGCCGGAGCCCGTGGAGAA
>probe:Drosophila_2:1624352_at:298:107; Interrogation_Position=398; Antisense; AGAACCATCTGGAGGCTAACAACGG
>probe:Drosophila_2:1624352_at:443:331; Interrogation_Position=431; Antisense; GCGGCATGGAGAGCCTCTTCGGCAC
>probe:Drosophila_2:1624352_at:288:61; Interrogation_Position=460; Antisense; ATGTACTTCGGCACCGAGAACTCGA
>probe:Drosophila_2:1624352_at:427:423; Interrogation_Position=475; Antisense; GAGAACTCGACGGTGGTCACCACGC
>probe:Drosophila_2:1624352_at:494:89; Interrogation_Position=559; Antisense; AGTACGCCCAGTATTGTTTTAATAT
>probe:Drosophila_2:1624352_at:250:155; Interrogation_Position=58; Antisense; ACAGCATCCGCATCGCCAGGAGGAG
>probe:Drosophila_2:1624352_at:655:559; Interrogation_Position=82; Antisense; GGAAAAACAGTAGCCGCCACCATGA

Paste this into a BLAST search page for me
GGCTAGCGAGCCATCAGTGAGGCATGTGCCACAGCCGTATGCCCAAAGTGAGCTTCGACTCGACCAATGTGATCGGTGATCGATGGCCAAAGCCAGCCGAAGGAAGCGGTGCTCCAGACGCATTCACTCCCGGATCCAGGCCAAAGATACTACATCGGCCGGAGCCCGTGGAGAAAGAACCATCTGGAGGCTAACAACGGGCGGCATGGAGAGCCTCTTCGGCACATGTACTTCGGCACCGAGAACTCGAGAGAACTCGACGGTGGTCACCACGCAGTACGCCCAGTATTGTTTTAATATACAGCATCCGCATCGCCAGGAGGAGGGAAAAACAGTAGCCGCCACCATGA

Full Affymetrix probeset data:

Annotations for 1624352_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720