FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624354_at:

>probe:Drosophila_2:1624354_at:274:377; Interrogation_Position=2004; Antisense; GAAGAACGCCTACGGCGACTTCCGG
>probe:Drosophila_2:1624354_at:47:287; Interrogation_Position=2035; Antisense; CTGTACGCCGTGGTCAATCATGTGG
>probe:Drosophila_2:1624354_at:462:239; Interrogation_Position=2050; Antisense; AATCATGTGGGCACCATCGACACCG
>probe:Drosophila_2:1624354_at:88:279; Interrogation_Position=2079; Antisense; CTATACGGCGTATGTGCGGCACCAG
>probe:Drosophila_2:1624354_at:153:399; Interrogation_Position=2107; Antisense; GACACGTGGGTCAAGTGCGATGATC
>probe:Drosophila_2:1624354_at:256:453; Interrogation_Position=2128; Antisense; GATCATGTGATAACGATGGCATCGC
>probe:Drosophila_2:1624354_at:663:67; Interrogation_Position=2143; Antisense; ATGGCATCGCTCAAGCAGGTGCTGG
>probe:Drosophila_2:1624354_at:25:435; Interrogation_Position=2173; Antisense; GAGGGTTATTTATTGTTCTACCATA
>probe:Drosophila_2:1624354_at:262:663; Interrogation_Position=2241; Antisense; TAAAGCAGCGACTGCATCCCTCAAA
>probe:Drosophila_2:1624354_at:368:241; Interrogation_Position=2319; Antisense; AATACAGACAAGGACGCGGCAGCGC
>probe:Drosophila_2:1624354_at:602:133; Interrogation_Position=2332; Antisense; ACGCGGCAGCGCTTACATATTAAGT
>probe:Drosophila_2:1624354_at:489:529; Interrogation_Position=2418; Antisense; GGGTTATTCAAGCTCACAAACTCAA
>probe:Drosophila_2:1624354_at:204:385; Interrogation_Position=2504; Antisense; GAACACTCGATTTGTGGAGATACCC
>probe:Drosophila_2:1624354_at:277:551; Interrogation_Position=2519; Antisense; GGAGATACCCGTTTTGCTCTAAGTA

Paste this into a BLAST search page for me
GAAGAACGCCTACGGCGACTTCCGGCTGTACGCCGTGGTCAATCATGTGGAATCATGTGGGCACCATCGACACCGCTATACGGCGTATGTGCGGCACCAGGACACGTGGGTCAAGTGCGATGATCGATCATGTGATAACGATGGCATCGCATGGCATCGCTCAAGCAGGTGCTGGGAGGGTTATTTATTGTTCTACCATATAAAGCAGCGACTGCATCCCTCAAAAATACAGACAAGGACGCGGCAGCGCACGCGGCAGCGCTTACATATTAAGTGGGTTATTCAAGCTCACAAACTCAAGAACACTCGATTTGTGGAGATACCCGGAGATACCCGTTTTGCTCTAAGTA

Full Affymetrix probeset data:

Annotations for 1624354_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720