Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624355_at:

>probe:Drosophila_2:1624355_at:596:537; Interrogation_Position=1542; Antisense; GGTCACCATTCCAAAAGAGCTGGCT
>probe:Drosophila_2:1624355_at:660:417; Interrogation_Position=1558; Antisense; GAGCTGGCTGGTGCCATCATTGGTA
>probe:Drosophila_2:1624355_at:56:199; Interrogation_Position=1612; Antisense; AACGAGTCCAGTGCGTACATCACCA
>probe:Drosophila_2:1624355_at:686:301; Interrogation_Position=1646; Antisense; CCCTGCCAAACTCGAACGATCGTAT
>probe:Drosophila_2:1624355_at:560:137; Interrogation_Position=1661; Antisense; ACGATCGTATCATCACCATCTCGGG
>probe:Drosophila_2:1624355_at:209:639; Interrogation_Position=1681; Antisense; TCGGGCACGCCGAAGCAAATACAAA
>probe:Drosophila_2:1624355_at:272:169; Interrogation_Position=1703; Antisense; AAATGGCCCAGTATCTGCTGCAACA
>probe:Drosophila_2:1624355_at:313:621; Interrogation_Position=1718; Antisense; TGCTGCAACAGAGCGTACACGAGAA
>probe:Drosophila_2:1624355_at:617:523; Interrogation_Position=1764; Antisense; GGGCAAGGACTTGAACAGCTACAAC
>probe:Drosophila_2:1624355_at:101:637; Interrogation_Position=1842; Antisense; TCGAGAATTGCTGCGTTTCACGTTT
>probe:Drosophila_2:1624355_at:564:199; Interrogation_Position=1899; Antisense; AACGCCCAGGGCAAGAGAGCATCCT
>probe:Drosophila_2:1624355_at:517:425; Interrogation_Position=1913; Antisense; GAGAGCATCCTCCAAATACGAAAGA
>probe:Drosophila_2:1624355_at:179:511; Interrogation_Position=1966; Antisense; GTGAATATTATACGCCCCAAATGGA
>probe:Drosophila_2:1624355_at:502:279; Interrogation_Position=2047; Antisense; CTCGTCGTCACCAGTTTGCAATTTG

Paste this into a BLAST search page for me
GGTCACCATTCCAAAAGAGCTGGCTGAGCTGGCTGGTGCCATCATTGGTAAACGAGTCCAGTGCGTACATCACCACCCTGCCAAACTCGAACGATCGTATACGATCGTATCATCACCATCTCGGGTCGGGCACGCCGAAGCAAATACAAAAAATGGCCCAGTATCTGCTGCAACATGCTGCAACAGAGCGTACACGAGAAGGGCAAGGACTTGAACAGCTACAACTCGAGAATTGCTGCGTTTCACGTTTAACGCCCAGGGCAAGAGAGCATCCTGAGAGCATCCTCCAAATACGAAAGAGTGAATATTATACGCCCCAAATGGACTCGTCGTCACCAGTTTGCAATTTG

Full Affymetrix probeset data:

Annotations for 1624355_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime