FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624357_at:

>probe:Drosophila_2:1624357_at:13:195; Interrogation_Position=127; Antisense; AACTGAGGTCCCACCTGAGGAAGAT
>probe:Drosophila_2:1624357_at:422:5; Interrogation_Position=190; Antisense; ATTGGGCTCCGAAAATGATCACCGT
>probe:Drosophila_2:1624357_at:29:505; Interrogation_Position=251; Antisense; GTCCTGATTGCCGAGAAGTACACCA
>probe:Drosophila_2:1624357_at:569:613; Interrogation_Position=279; Antisense; TGAACGACTTAACCCATGTCACCAA
>probe:Drosophila_2:1624357_at:499:493; Interrogation_Position=296; Antisense; GTCACCAATTCCCAGAATCTTGTGG
>probe:Drosophila_2:1624357_at:132:401; Interrogation_Position=323; Antisense; GACATCCACTTTCTGCATACGAAGA
>probe:Drosophila_2:1624357_at:578:311; Interrogation_Position=350; Antisense; GCCAAGATCCTGGAGAGCCTCAATC
>probe:Drosophila_2:1624357_at:173:69; Interrogation_Position=405; Antisense; AGGCCTACGATGACCATTGCAAGAA
>probe:Drosophila_2:1624357_at:513:227; Interrogation_Position=428; Antisense; AAGGCGCTCAAGGTCAAGGCCGAGA
>probe:Drosophila_2:1624357_at:158:343; Interrogation_Position=471; Antisense; GCTTCGATGAGTTCACCGTGATGAA
>probe:Drosophila_2:1624357_at:61:107; Interrogation_Position=544; Antisense; AGAAATTCGCGCTAAGACGGCTTTA
>probe:Drosophila_2:1624357_at:45:325; Interrogation_Position=592; Antisense; GCGAGAATTTGTTAACACCACCCAA
>probe:Drosophila_2:1624357_at:24:25; Interrogation_Position=633; Antisense; ATATCCGTGTTCTAGGCCAGATCGA
>probe:Drosophila_2:1624357_at:406:579; Interrogation_Position=647; Antisense; GGCCAGATCGAACATGACCTCATGT

Paste this into a BLAST search page for me
AACTGAGGTCCCACCTGAGGAAGATATTGGGCTCCGAAAATGATCACCGTGTCCTGATTGCCGAGAAGTACACCATGAACGACTTAACCCATGTCACCAAGTCACCAATTCCCAGAATCTTGTGGGACATCCACTTTCTGCATACGAAGAGCCAAGATCCTGGAGAGCCTCAATCAGGCCTACGATGACCATTGCAAGAAAAGGCGCTCAAGGTCAAGGCCGAGAGCTTCGATGAGTTCACCGTGATGAAAGAAATTCGCGCTAAGACGGCTTTAGCGAGAATTTGTTAACACCACCCAAATATCCGTGTTCTAGGCCAGATCGAGGCCAGATCGAACATGACCTCATGT

Full Affymetrix probeset data:

Annotations for 1624357_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720