FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624358_at:

>probe:Drosophila_2:1624358_at:610:725; Interrogation_Position=1831; Antisense; TTGATTATATCGAGGCAGCCGCAGA
>probe:Drosophila_2:1624358_at:60:243; Interrogation_Position=1855; Antisense; AATAGATATGCGCTGGCCTTCCTCA
>probe:Drosophila_2:1624358_at:466:21; Interrogation_Position=1933; Antisense; ATATTCAAGCTGAGCATCCTCACGC
>probe:Drosophila_2:1624358_at:465:135; Interrogation_Position=1954; Antisense; ACGCTGGTACGCTTCACCGTATGGA
>probe:Drosophila_2:1624358_at:46:133; Interrogation_Position=1969; Antisense; ACCGTATGGATGTCGCTGGGATTCA
>probe:Drosophila_2:1624358_at:390:413; Interrogation_Position=2047; Antisense; GACCTGGAGTTGCATGTCGACTACA
>probe:Drosophila_2:1624358_at:620:227; Interrogation_Position=2089; Antisense; AAGGCCGTGTGGGATCAGCAATCGT
>probe:Drosophila_2:1624358_at:352:511; Interrogation_Position=2152; Antisense; GTGAAGCAGCCGTCGACAGAGCAGC
>probe:Drosophila_2:1624358_at:474:265; Interrogation_Position=2168; Antisense; CAGAGCAGCGCTATAACTACGGAAA
>probe:Drosophila_2:1624358_at:646:559; Interrogation_Position=2188; Antisense; GGAAAGACCACGTCATCTTCGTCGT
>probe:Drosophila_2:1624358_at:72:107; Interrogation_Position=2272; Antisense; AGCACTGCGGGCTTAAACCGACCTG
>probe:Drosophila_2:1624358_at:620:535; Interrogation_Position=2347; Antisense; GGTCCTCCGATGGAACGCCAGTACA
>probe:Drosophila_2:1624358_at:683:157; Interrogation_Position=2369; Antisense; ACACTGGCCAGTTCAGCATGTTCGT
>probe:Drosophila_2:1624358_at:639:57; Interrogation_Position=2386; Antisense; ATGTTCGTGGACGAGGGCCAGTTCC

Paste this into a BLAST search page for me
TTGATTATATCGAGGCAGCCGCAGAAATAGATATGCGCTGGCCTTCCTCAATATTCAAGCTGAGCATCCTCACGCACGCTGGTACGCTTCACCGTATGGAACCGTATGGATGTCGCTGGGATTCAGACCTGGAGTTGCATGTCGACTACAAAGGCCGTGTGGGATCAGCAATCGTGTGAAGCAGCCGTCGACAGAGCAGCCAGAGCAGCGCTATAACTACGGAAAGGAAAGACCACGTCATCTTCGTCGTAGCACTGCGGGCTTAAACCGACCTGGGTCCTCCGATGGAACGCCAGTACAACACTGGCCAGTTCAGCATGTTCGTATGTTCGTGGACGAGGGCCAGTTCC

Full Affymetrix probeset data:

Annotations for 1624358_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720