FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624360_at:

>probe:Drosophila_2:1624360_at:387:497; Interrogation_Position=1232; Antisense; GTCATGTGGCGCACGTGGCCCATCC
>probe:Drosophila_2:1624360_at:62:39; Interrogation_Position=1371; Antisense; ATCGGAACCCGTTCCTCACAATGGG
>probe:Drosophila_2:1624360_at:443:469; Interrogation_Position=1381; Antisense; GTTCCTCACAATGGGCAGCAGGGCA
>probe:Drosophila_2:1624360_at:33:265; Interrogation_Position=1440; Antisense; CAGCAGCGTACTCAACCACAATGGA
>probe:Drosophila_2:1624360_at:268:589; Interrogation_Position=1500; Antisense; TGGAGGATCCTCCAGCGTGCTGACC
>probe:Drosophila_2:1624360_at:76:115; Interrogation_Position=1525; Antisense; AGCAGTCCCACATCGGCACTGGGTT
>probe:Drosophila_2:1624360_at:467:565; Interrogation_Position=1539; Antisense; GGCACTGGGTTTCCGCGACATGATC
>probe:Drosophila_2:1624360_at:551:401; Interrogation_Position=1555; Antisense; GACATGATCTTCGAGCAGAACCAAT
>probe:Drosophila_2:1624360_at:94:115; Interrogation_Position=1568; Antisense; AGCAGAACCAATCCTGCCAACTGGA
>probe:Drosophila_2:1624360_at:292:575; Interrogation_Position=1677; Antisense; GGCGGTGATCAGTAGCCACCACCAC
>probe:Drosophila_2:1624360_at:196:291; Interrogation_Position=1721; Antisense; CGCTTAGCGGGAACCTGGGCCAGCT
>probe:Drosophila_2:1624360_at:639:119; Interrogation_Position=1751; Antisense; AGCTGAGCAATCTGAGCCACTACCG
>probe:Drosophila_2:1624360_at:121:143; Interrogation_Position=1769; Antisense; ACTACCGACCGCATGTGGGCCACTA
>probe:Drosophila_2:1624360_at:117:595; Interrogation_Position=1784; Antisense; TGGGCCACTACCAGGAGTACGGCAT

Paste this into a BLAST search page for me
GTCATGTGGCGCACGTGGCCCATCCATCGGAACCCGTTCCTCACAATGGGGTTCCTCACAATGGGCAGCAGGGCACAGCAGCGTACTCAACCACAATGGATGGAGGATCCTCCAGCGTGCTGACCAGCAGTCCCACATCGGCACTGGGTTGGCACTGGGTTTCCGCGACATGATCGACATGATCTTCGAGCAGAACCAATAGCAGAACCAATCCTGCCAACTGGAGGCGGTGATCAGTAGCCACCACCACCGCTTAGCGGGAACCTGGGCCAGCTAGCTGAGCAATCTGAGCCACTACCGACTACCGACCGCATGTGGGCCACTATGGGCCACTACCAGGAGTACGGCAT

Full Affymetrix probeset data:

Annotations for 1624360_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720