Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624362_at:

>probe:Drosophila_2:1624362_at:429:59; Interrogation_Position=13; Antisense; ATGTTCAAGCTGCTGGTTGTCGTTT
>probe:Drosophila_2:1624362_at:380:89; Interrogation_Position=134; Antisense; AGTACTACTACGGAGCTAGCCCATA
>probe:Drosophila_2:1624362_at:166:669; Interrogation_Position=136; Antisense; TACTACTACGGAGCTAGCCCATACG
>probe:Drosophila_2:1624362_at:104:669; Interrogation_Position=139; Antisense; TACTACGGAGCTAGCCCATACGCCT
>probe:Drosophila_2:1624362_at:357:133; Interrogation_Position=158; Antisense; ACGCCTACTCCGGAGGATACTACGA
>probe:Drosophila_2:1624362_at:623:315; Interrogation_Position=160; Antisense; GCCTACTCCGGAGGATACTACGATT
>probe:Drosophila_2:1624362_at:422:629; Interrogation_Position=163; Antisense; TACTCCGGAGGATACTACGATTCGC
>probe:Drosophila_2:1624362_at:274:549; Interrogation_Position=169; Antisense; GGAGGATACTACGATTCGCCCTACT
>probe:Drosophila_2:1624362_at:219:649; Interrogation_Position=17; Antisense; TCAAGCTGCTGGTTGTCGTTTTCGC
>probe:Drosophila_2:1624362_at:565:455; Interrogation_Position=173; Antisense; GATACTACGATTCGCCCTACTCCTA
>probe:Drosophila_2:1624362_at:587:707; Interrogation_Position=183; Antisense; TTCGCCCTACTCCTACTACGGCTAA
>probe:Drosophila_2:1624362_at:310:119; Interrogation_Position=20; Antisense; AGCTGCTGGTTGTCGTTTTCGCTGC
>probe:Drosophila_2:1624362_at:508:589; Interrogation_Position=26; Antisense; TGGTTGTCGTTTTCGCTGCCCTCTT
>probe:Drosophila_2:1624362_at:645:337; Interrogation_Position=58; Antisense; GCTCTGGCTGTTCCCGCTCCAGTTG

Paste this into a BLAST search page for me
ATGTTCAAGCTGCTGGTTGTCGTTTAGTACTACTACGGAGCTAGCCCATATACTACTACGGAGCTAGCCCATACGTACTACGGAGCTAGCCCATACGCCTACGCCTACTCCGGAGGATACTACGAGCCTACTCCGGAGGATACTACGATTTACTCCGGAGGATACTACGATTCGCGGAGGATACTACGATTCGCCCTACTTCAAGCTGCTGGTTGTCGTTTTCGCGATACTACGATTCGCCCTACTCCTATTCGCCCTACTCCTACTACGGCTAAAGCTGCTGGTTGTCGTTTTCGCTGCTGGTTGTCGTTTTCGCTGCCCTCTTGCTCTGGCTGTTCCCGCTCCAGTTG

Full Affymetrix probeset data:

Annotations for 1624362_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime