FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624363_at:

>probe:Drosophila_2:1624363_at:506:505; Interrogation_Position=156; Antisense; GTGCTCCTACCGCAACTCGGAGGAT
>probe:Drosophila_2:1624363_at:234:435; Interrogation_Position=175; Antisense; GAGGATGAGACCATCTTTCTCAAGT
>probe:Drosophila_2:1624363_at:395:697; Interrogation_Position=190; Antisense; TTTCTCAAGTATCTGCCGCTGCTGA
>probe:Drosophila_2:1624363_at:410:621; Interrogation_Position=209; Antisense; TGCTGAGACGCGGACAGGACTACGT
>probe:Drosophila_2:1624363_at:282:73; Interrogation_Position=224; Antisense; AGGACTACGTGGACTTCGGCAAGGA
>probe:Drosophila_2:1624363_at:592:65; Interrogation_Position=248; Antisense; ATGGCAAGTGCCTCAAGCGGGCCAT
>probe:Drosophila_2:1624363_at:403:559; Interrogation_Position=279; Antisense; GGACACCTTCAAGACCATCGTGGAG
>probe:Drosophila_2:1624363_at:263:407; Interrogation_Position=304; Antisense; GACTGTGGACAGCAGAAGGTCACCT
>probe:Drosophila_2:1624363_at:428:109; Interrogation_Position=317; Antisense; AGAAGGTCACCTGCGGCAACAAGGA
>probe:Drosophila_2:1624363_at:378:185; Interrogation_Position=334; Antisense; AACAAGGATCGCTTCACCGGAGTTT
>probe:Drosophila_2:1624363_at:643:323; Interrogation_Position=35; Antisense; GCGCTCCAAAGATGCACAACCGTTG
>probe:Drosophila_2:1624363_at:609:653; Interrogation_Position=374; Antisense; TCAAGTGTCCCTAAATCCGAGGAGT
>probe:Drosophila_2:1624363_at:495:679; Interrogation_Position=462; Antisense; TATGTGCTACCCATTCAATTACAGG
>probe:Drosophila_2:1624363_at:605:199; Interrogation_Position=52; Antisense; AACCGTTGCGGATCCATTTGGCTGC

Paste this into a BLAST search page for me
GTGCTCCTACCGCAACTCGGAGGATGAGGATGAGACCATCTTTCTCAAGTTTTCTCAAGTATCTGCCGCTGCTGATGCTGAGACGCGGACAGGACTACGTAGGACTACGTGGACTTCGGCAAGGAATGGCAAGTGCCTCAAGCGGGCCATGGACACCTTCAAGACCATCGTGGAGGACTGTGGACAGCAGAAGGTCACCTAGAAGGTCACCTGCGGCAACAAGGAAACAAGGATCGCTTCACCGGAGTTTGCGCTCCAAAGATGCACAACCGTTGTCAAGTGTCCCTAAATCCGAGGAGTTATGTGCTACCCATTCAATTACAGGAACCGTTGCGGATCCATTTGGCTGC

Full Affymetrix probeset data:

Annotations for 1624363_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720