FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624364_at:

>probe:Drosophila_2:1624364_at:612:29; Interrogation_Position=2615; Antisense; ATACTCGGCGTTTTTGATGGCCACC
>probe:Drosophila_2:1624364_at:704:423; Interrogation_Position=2630; Antisense; GATGGCCACCCCACGTTTAATGGAA
>probe:Drosophila_2:1624364_at:675:713; Interrogation_Position=2674; Antisense; TTCAGGCGCCGGCAGATTGTGTATC
>probe:Drosophila_2:1624364_at:639:683; Interrogation_Position=2695; Antisense; TATCCGCTGTCTATACTGTGCTGGC
>probe:Drosophila_2:1624364_at:544:99; Interrogation_Position=2727; Antisense; AGAGGCCACGTAACGCAGGATGCTC
>probe:Drosophila_2:1624364_at:402:291; Interrogation_Position=2758; Antisense; CGGGTTCTCCCATATATACGATCAA
>probe:Drosophila_2:1624364_at:269:713; Interrogation_Position=2787; Antisense; TTCATACCCGCCATTGATTCATTTG
>probe:Drosophila_2:1624364_at:342:717; Interrogation_Position=2861; Antisense; TTCGGTGTTCCATCACTGGCAGATA
>probe:Drosophila_2:1624364_at:656:213; Interrogation_Position=2907; Antisense; AAGAGCATCATAATCCGGCCACTGG
>probe:Drosophila_2:1624364_at:425:429; Interrogation_Position=2961; Antisense; GAGTTTATGATCAAGACGCGTCGCA
>probe:Drosophila_2:1624364_at:253:11; Interrogation_Position=3020; Antisense; ATTCTTCGACGATCCTATGTTGCTG
>probe:Drosophila_2:1624364_at:44:279; Interrogation_Position=3034; Antisense; CTATGTTGCTGGAGTTGGCACGCCA
>probe:Drosophila_2:1624364_at:434:77; Interrogation_Position=3058; Antisense; AGGATGTGCTGATCAACTACCCGCT
>probe:Drosophila_2:1624364_at:36:299; Interrogation_Position=3079; Antisense; CGCTTTAGACTTCCCACAAATCAGG

Paste this into a BLAST search page for me
ATACTCGGCGTTTTTGATGGCCACCGATGGCCACCCCACGTTTAATGGAATTCAGGCGCCGGCAGATTGTGTATCTATCCGCTGTCTATACTGTGCTGGCAGAGGCCACGTAACGCAGGATGCTCCGGGTTCTCCCATATATACGATCAATTCATACCCGCCATTGATTCATTTGTTCGGTGTTCCATCACTGGCAGATAAAGAGCATCATAATCCGGCCACTGGGAGTTTATGATCAAGACGCGTCGCAATTCTTCGACGATCCTATGTTGCTGCTATGTTGCTGGAGTTGGCACGCCAAGGATGTGCTGATCAACTACCCGCTCGCTTTAGACTTCCCACAAATCAGG

Full Affymetrix probeset data:

Annotations for 1624364_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720