FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624365_at:

>probe:Drosophila_2:1624365_at:662:627; Interrogation_Position=2259; Antisense; TCCATCCCGAACTGACAACTTTCAT
>probe:Drosophila_2:1624365_at:163:191; Interrogation_Position=2275; Antisense; AACTTTCATGTTCTCTTGTCTTTAA
>probe:Drosophila_2:1624365_at:301:47; Interrogation_Position=2314; Antisense; ATGGTCGTACATGTCTTCATTTTTT
>probe:Drosophila_2:1624365_at:487:403; Interrogation_Position=2441; Antisense; GACTTCATTGTCAGTTCGAGATTGG
>probe:Drosophila_2:1624365_at:373:721; Interrogation_Position=2518; Antisense; TTGAGTATTTTCTGTTGCCTAGCGT
>probe:Drosophila_2:1624365_at:64:317; Interrogation_Position=2534; Antisense; GCCTAGCGTGATTTGGCATACAAAA
>probe:Drosophila_2:1624365_at:24:59; Interrogation_Position=2590; Antisense; ATGATAGTATACAGTGCGACTCCCC
>probe:Drosophila_2:1624365_at:544:71; Interrogation_Position=2619; Antisense; AGGCGGCCTATCGTCTAAGTTTGGT
>probe:Drosophila_2:1624365_at:65:477; Interrogation_Position=2658; Antisense; GTTTTTTACCAAGCGAACGATACAT
>probe:Drosophila_2:1624365_at:673:655; Interrogation_Position=2678; Antisense; TACATTTTACAATGCCGTTGGCGGT
>probe:Drosophila_2:1624365_at:52:505; Interrogation_Position=2701; Antisense; GTCCGCGGGCCAAGCCAAGAGACAA
>probe:Drosophila_2:1624365_at:192:631; Interrogation_Position=2743; Antisense; TCCGTACGTAGTAACCGAACATTTG
>probe:Drosophila_2:1624365_at:341:385; Interrogation_Position=2759; Antisense; GAACATTTGTACAAGGCCGTGCGAT
>probe:Drosophila_2:1624365_at:58:579; Interrogation_Position=2773; Antisense; GGCCGTGCGATTCTCATAACAAGTA

Paste this into a BLAST search page for me
TCCATCCCGAACTGACAACTTTCATAACTTTCATGTTCTCTTGTCTTTAAATGGTCGTACATGTCTTCATTTTTTGACTTCATTGTCAGTTCGAGATTGGTTGAGTATTTTCTGTTGCCTAGCGTGCCTAGCGTGATTTGGCATACAAAAATGATAGTATACAGTGCGACTCCCCAGGCGGCCTATCGTCTAAGTTTGGTGTTTTTTACCAAGCGAACGATACATTACATTTTACAATGCCGTTGGCGGTGTCCGCGGGCCAAGCCAAGAGACAATCCGTACGTAGTAACCGAACATTTGGAACATTTGTACAAGGCCGTGCGATGGCCGTGCGATTCTCATAACAAGTA

Full Affymetrix probeset data:

Annotations for 1624365_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720