Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624366_at:

>probe:Drosophila_2:1624366_at:236:163; Interrogation_Position=1804; Antisense; AAATTGCCTATGCTGGTGAGTCCGC
>probe:Drosophila_2:1624366_at:629:341; Interrogation_Position=1846; Antisense; GCATTGGTCTGGTCCCGTTCGATGG
>probe:Drosophila_2:1624366_at:694:439; Interrogation_Position=1866; Antisense; GATGGCTCGCACATGTACCGGATAC
>probe:Drosophila_2:1624366_at:167:255; Interrogation_Position=1895; Antisense; CAACGGATCGCTAGCCCCAATAAGG
>probe:Drosophila_2:1624366_at:196:241; Interrogation_Position=1913; Antisense; AATAAGGCCCTTGGGCTCACAGCTC
>probe:Drosophila_2:1624366_at:38:715; Interrogation_Position=1986; Antisense; TTCTACTGCGATGCCTGCAACATTA
>probe:Drosophila_2:1624366_at:571:13; Interrogation_Position=2007; Antisense; ATTACGCTCAACCATCTGAAGTCGG
>probe:Drosophila_2:1624366_at:207:615; Interrogation_Position=2032; Antisense; TGAATCAGCATGAGCAGGGACGCAT
>probe:Drosophila_2:1624366_at:706:81; Interrogation_Position=2047; Antisense; AGGGACGCATGCACCGCCGGAATAT
>probe:Drosophila_2:1624366_at:514:365; Interrogation_Position=2066; Antisense; GAATATGCACAGGTTGCCCGCCCAA
>probe:Drosophila_2:1624366_at:407:207; Interrogation_Position=2089; Antisense; AAGCGGTCTTCTTCGAGTGATCTTG
>probe:Drosophila_2:1624366_at:593:187; Interrogation_Position=2257; Antisense; AACAGCATGATGTCTGGAGTTCCCA
>probe:Drosophila_2:1624366_at:582:587; Interrogation_Position=2271; Antisense; TGGAGTTCCCAGTGGCCAAACCAAC
>probe:Drosophila_2:1624366_at:283:283; Interrogation_Position=2299; Antisense; CTGCTGCGCTGTGTGTTATTTGCAA

Paste this into a BLAST search page for me
AAATTGCCTATGCTGGTGAGTCCGCGCATTGGTCTGGTCCCGTTCGATGGGATGGCTCGCACATGTACCGGATACCAACGGATCGCTAGCCCCAATAAGGAATAAGGCCCTTGGGCTCACAGCTCTTCTACTGCGATGCCTGCAACATTAATTACGCTCAACCATCTGAAGTCGGTGAATCAGCATGAGCAGGGACGCATAGGGACGCATGCACCGCCGGAATATGAATATGCACAGGTTGCCCGCCCAAAAGCGGTCTTCTTCGAGTGATCTTGAACAGCATGATGTCTGGAGTTCCCATGGAGTTCCCAGTGGCCAAACCAACCTGCTGCGCTGTGTGTTATTTGCAA

Full Affymetrix probeset data:

Annotations for 1624366_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime