FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624369_at:

>probe:Drosophila_2:1624369_at:665:241; Interrogation_Position=1008; Antisense; AATTGGCTTATTTCCGGAGTCCTTG
>probe:Drosophila_2:1624369_at:93:423; Interrogation_Position=1032; Antisense; GAGAAAAGACTGCAGCCGCTACCGT
>probe:Drosophila_2:1624369_at:631:633; Interrogation_Position=1059; Antisense; TCGTTGGCCATTAGCGGTCGTATGA
>probe:Drosophila_2:1624369_at:498:677; Interrogation_Position=1097; Antisense; TAGTTTTCGGCTGGGATGTGGCCTC
>probe:Drosophila_2:1624369_at:150:19; Interrogation_Position=686; Antisense; ATTTGTGTGCCAGTACTTGCAGTCC
>probe:Drosophila_2:1624369_at:601:493; Interrogation_Position=711; Antisense; GTCACCAAACGTCTGGCGCTAGGAT
>probe:Drosophila_2:1624369_at:716:73; Interrogation_Position=731; Antisense; AGGATCGGAGTTCGCCTATCACTAC
>probe:Drosophila_2:1624369_at:46:555; Interrogation_Position=801; Antisense; GGACGTTACGCCTTCGGTGATACCG
>probe:Drosophila_2:1624369_at:704:455; Interrogation_Position=819; Antisense; GATACCGTGTGGTCTTGCACTTTGG
>probe:Drosophila_2:1624369_at:413:541; Interrogation_Position=852; Antisense; GGATTCCACCTTAGTTACTACCAGA
>probe:Drosophila_2:1624369_at:318:109; Interrogation_Position=874; Antisense; AGAAGGCCAGTGATCAGCTACAGAT
>probe:Drosophila_2:1624369_at:374:363; Interrogation_Position=917; Antisense; GAATATCCGCCAGCAAGAGTCGACG
>probe:Drosophila_2:1624369_at:588:579; Interrogation_Position=941; Antisense; GGCCACGGTGGCATACCAGATTGAT
>probe:Drosophila_2:1624369_at:330:569; Interrogation_Position=993; Antisense; GGCAGTCTCGATTCCAATTGGCTTA

Paste this into a BLAST search page for me
AATTGGCTTATTTCCGGAGTCCTTGGAGAAAAGACTGCAGCCGCTACCGTTCGTTGGCCATTAGCGGTCGTATGATAGTTTTCGGCTGGGATGTGGCCTCATTTGTGTGCCAGTACTTGCAGTCCGTCACCAAACGTCTGGCGCTAGGATAGGATCGGAGTTCGCCTATCACTACGGACGTTACGCCTTCGGTGATACCGGATACCGTGTGGTCTTGCACTTTGGGGATTCCACCTTAGTTACTACCAGAAGAAGGCCAGTGATCAGCTACAGATGAATATCCGCCAGCAAGAGTCGACGGGCCACGGTGGCATACCAGATTGATGGCAGTCTCGATTCCAATTGGCTTA

Full Affymetrix probeset data:

Annotations for 1624369_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720