FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624373_at:

>probe:Drosophila_2:1624373_at:7:183; Interrogation_Position=1025; Antisense; AAAACTTGACGAAACATTGAATATA
>probe:Drosophila_2:1624373_at:216:349; Interrogation_Position=463; Antisense; GCATGGCGCGCCAAGCAGAAACACG
>probe:Drosophila_2:1624373_at:116:577; Interrogation_Position=467; Antisense; GGCGCGCCAAGCAGAAACACGCAAT
>probe:Drosophila_2:1624373_at:409:307; Interrogation_Position=472; Antisense; GCCAAGCAGAAACACGCAATTACTA
>probe:Drosophila_2:1624373_at:348:351; Interrogation_Position=477; Antisense; GCAGAAACACGCAATTACTAGAAAT
>probe:Drosophila_2:1624373_at:175:707; Interrogation_Position=506; Antisense; TTACATTTAAATGATCTGCGACATA
>probe:Drosophila_2:1624373_at:722:165; Interrogation_Position=514; Antisense; AAATGATCTGCGACATATAAATGTA
>probe:Drosophila_2:1624373_at:385:485; Interrogation_Position=536; Antisense; GTAGATATGTATATAAAAGCTGCAA
>probe:Drosophila_2:1624373_at:448:417; Interrogation_Position=684; Antisense; GAGCGGGGAGTGAAGATTCATCCAA
>probe:Drosophila_2:1624373_at:283:121; Interrogation_Position=873; Antisense; AGCGGCAACAACTCCCTAATAATCG
>probe:Drosophila_2:1624373_at:16:567; Interrogation_Position=876; Antisense; GGCAACAACTCCCTAATAATCGCAA
>probe:Drosophila_2:1624373_at:591:185; Interrogation_Position=879; Antisense; AACAACTCCCTAATAATCGCAAAGA
>probe:Drosophila_2:1624373_at:202:253; Interrogation_Position=881; Antisense; CAACTCCCTAATAATCGCAAAGAGC
>probe:Drosophila_2:1624373_at:399:239; Interrogation_Position=924; Antisense; AATAATCTATGCTTCATTTAAGTTT

Paste this into a BLAST search page for me
AAAACTTGACGAAACATTGAATATAGCATGGCGCGCCAAGCAGAAACACGGGCGCGCCAAGCAGAAACACGCAATGCCAAGCAGAAACACGCAATTACTAGCAGAAACACGCAATTACTAGAAATTTACATTTAAATGATCTGCGACATAAAATGATCTGCGACATATAAATGTAGTAGATATGTATATAAAAGCTGCAAGAGCGGGGAGTGAAGATTCATCCAAAGCGGCAACAACTCCCTAATAATCGGGCAACAACTCCCTAATAATCGCAAAACAACTCCCTAATAATCGCAAAGACAACTCCCTAATAATCGCAAAGAGCAATAATCTATGCTTCATTTAAGTTT

Full Affymetrix probeset data:

Annotations for 1624373_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720