FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624375_at:

>probe:Drosophila_2:1624375_at:237:67; Interrogation_Position=1080; Antisense; ATGGCAGTTTTACCGATCTCAACAA
>probe:Drosophila_2:1624375_at:508:441; Interrogation_Position=1132; Antisense; GATGGTGTCCATTGGCCCGAACAAC
>probe:Drosophila_2:1624375_at:398:625; Interrogation_Position=1164; Antisense; TGCCCGCCAGTGTCTTCGAGAATAT
>probe:Drosophila_2:1624375_at:74:561; Interrogation_Position=1218; Antisense; GGAAACTACTGGTCACGATCTTCGA
>probe:Drosophila_2:1624375_at:416:37; Interrogation_Position=1235; Antisense; ATCTTCGACCGGGAAACTCTGGCCA
>probe:Drosophila_2:1624375_at:227:581; Interrogation_Position=1254; Antisense; TGGCCACCCATTCGATGACGGGCAA
>probe:Drosophila_2:1624375_at:58:225; Interrogation_Position=1295; Antisense; AAGGATCAGGACAAGCCGCTCAAGC
>probe:Drosophila_2:1624375_at:728:121; Interrogation_Position=1317; Antisense; AGCGAATGCTCGATCCTGGGAAGAT
>probe:Drosophila_2:1624375_at:39:49; Interrogation_Position=1340; Antisense; ATCCAGGACATCATATTCGCAGTGA
>probe:Drosophila_2:1624375_at:384:507; Interrogation_Position=1417; Antisense; GTGCGCCGACGAGAACAAGATGATG
>probe:Drosophila_2:1624375_at:370:55; Interrogation_Position=1439; Antisense; ATGAAGATCCAGAACGTCAAGCGAC
>probe:Drosophila_2:1624375_at:299:495; Interrogation_Position=1454; Antisense; GTCAAGCGACGCAGCAGTGGCATCA
>probe:Drosophila_2:1624375_at:142:183; Interrogation_Position=1560; Antisense; AAAACGGCTGTAATGCCCGCACAAA
>probe:Drosophila_2:1624375_at:447:477; Interrogation_Position=1604; Antisense; GTAGAGCACTACATCGAACTAACGT

Paste this into a BLAST search page for me
ATGGCAGTTTTACCGATCTCAACAAGATGGTGTCCATTGGCCCGAACAACTGCCCGCCAGTGTCTTCGAGAATATGGAAACTACTGGTCACGATCTTCGAATCTTCGACCGGGAAACTCTGGCCATGGCCACCCATTCGATGACGGGCAAAAGGATCAGGACAAGCCGCTCAAGCAGCGAATGCTCGATCCTGGGAAGATATCCAGGACATCATATTCGCAGTGAGTGCGCCGACGAGAACAAGATGATGATGAAGATCCAGAACGTCAAGCGACGTCAAGCGACGCAGCAGTGGCATCAAAAACGGCTGTAATGCCCGCACAAAGTAGAGCACTACATCGAACTAACGT

Full Affymetrix probeset data:

Annotations for 1624375_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720