Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624378_at:

>probe:Drosophila_2:1624378_at:398:145; Interrogation_Position=6774; Antisense; ACTACTGATGCCACCACTGACTAAT
>probe:Drosophila_2:1624378_at:221:465; Interrogation_Position=6804; Antisense; GATTGGCAGTCAAGCACCCAACTTA
>probe:Drosophila_2:1624378_at:144:125; Interrogation_Position=6830; Antisense; AGCCGTTGCTGTCTAGTACGCTGGA
>probe:Drosophila_2:1624378_at:599:111; Interrogation_Position=6859; Antisense; AGCAACAACTGCTGGCTGTGGAAAA
>probe:Drosophila_2:1624378_at:245:559; Interrogation_Position=6878; Antisense; GGAAAAACTTTCCTGATCCCAATCA
>probe:Drosophila_2:1624378_at:484:127; Interrogation_Position=6975; Antisense; AGCCACGGCAACTAGTAGCTCCGGA
>probe:Drosophila_2:1624378_at:674:553; Interrogation_Position=6997; Antisense; GGAGCGGCCAACAAATCAGCAGGAA
>probe:Drosophila_2:1624378_at:464:73; Interrogation_Position=7017; Antisense; AGGAAGCCTATTTACCCTCAAGCAG
>probe:Drosophila_2:1624378_at:275:391; Interrogation_Position=7056; Antisense; GAAACTCATCGACAACGCTATCATG
>probe:Drosophila_2:1624378_at:147:223; Interrogation_Position=7185; Antisense; AAGGAGGGCGCCATGGCCATTAGCC
>probe:Drosophila_2:1624378_at:685:307; Interrogation_Position=7201; Antisense; CCATTAGCCGTAGCGCCGGAGGTAA
>probe:Drosophila_2:1624378_at:212:409; Interrogation_Position=7257; Antisense; GACGTGCAGCTTAAGCGGCGATCTT
>probe:Drosophila_2:1624378_at:36:333; Interrogation_Position=7300; Antisense; GCGGCGGCTCCATGGATATCACAAA
>probe:Drosophila_2:1624378_at:533:177; Interrogation_Position=7322; Antisense; AAACTCCACAATTCCATGGCTGCAG

Paste this into a BLAST search page for me
ACTACTGATGCCACCACTGACTAATGATTGGCAGTCAAGCACCCAACTTAAGCCGTTGCTGTCTAGTACGCTGGAAGCAACAACTGCTGGCTGTGGAAAAGGAAAAACTTTCCTGATCCCAATCAAGCCACGGCAACTAGTAGCTCCGGAGGAGCGGCCAACAAATCAGCAGGAAAGGAAGCCTATTTACCCTCAAGCAGGAAACTCATCGACAACGCTATCATGAAGGAGGGCGCCATGGCCATTAGCCCCATTAGCCGTAGCGCCGGAGGTAAGACGTGCAGCTTAAGCGGCGATCTTGCGGCGGCTCCATGGATATCACAAAAAACTCCACAATTCCATGGCTGCAG

Full Affymetrix probeset data:

Annotations for 1624378_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime