Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624381_at:

>probe:Drosophila_2:1624381_at:350:563; Interrogation_Position=1303; Antisense; GGAAGCCTTGCTTGTCAAGTGTTAT
>probe:Drosophila_2:1624381_at:520:475; Interrogation_Position=1323; Antisense; GTTATTCGATCTTTTGGTGTTCCCA
>probe:Drosophila_2:1624381_at:206:533; Interrogation_Position=1338; Antisense; GGTGTTCCCATTTGCTACACTTCGA
>probe:Drosophila_2:1624381_at:701:337; Interrogation_Position=1351; Antisense; GCTACACTTCGATTTCAAGGGCTCA
>probe:Drosophila_2:1624381_at:166:223; Interrogation_Position=1367; Antisense; AAGGGCTCAGGCAATTTCCGATTTC
>probe:Drosophila_2:1624381_at:158:315; Interrogation_Position=1395; Antisense; GCCATCACATTGTCCGCTGAGAAGA
>probe:Drosophila_2:1624381_at:610:95; Interrogation_Position=1423; Antisense; AGATTGCCATCGAGAGAGCCTACAA
>probe:Drosophila_2:1624381_at:99:65; Interrogation_Position=1452; Antisense; ATGGGCAATCCCTATCGTGAAATAT
>probe:Drosophila_2:1624381_at:303:513; Interrogation_Position=1518; Antisense; GTGTATGCCAATAACTACCTCGAGG
>probe:Drosophila_2:1624381_at:196:131; Interrogation_Position=1534; Antisense; ACCTCGAGGTTATTTTCACAAGCAA
>probe:Drosophila_2:1624381_at:115:663; Interrogation_Position=1642; Antisense; TAAACAGCTGCTCGTCAAATACATA
>probe:Drosophila_2:1624381_at:652:657; Interrogation_Position=1670; Antisense; TAAGTTACCTGATTACTGCCACAAG
>probe:Drosophila_2:1624381_at:409:689; Interrogation_Position=1767; Antisense; TATTCAGTTTCGAACGCGGCTTTGA
>probe:Drosophila_2:1624381_at:334:331; Interrogation_Position=1782; Antisense; GCGGCTTTGAATGTCGCCCTTTAAT

Paste this into a BLAST search page for me
GGAAGCCTTGCTTGTCAAGTGTTATGTTATTCGATCTTTTGGTGTTCCCAGGTGTTCCCATTTGCTACACTTCGAGCTACACTTCGATTTCAAGGGCTCAAAGGGCTCAGGCAATTTCCGATTTCGCCATCACATTGTCCGCTGAGAAGAAGATTGCCATCGAGAGAGCCTACAAATGGGCAATCCCTATCGTGAAATATGTGTATGCCAATAACTACCTCGAGGACCTCGAGGTTATTTTCACAAGCAATAAACAGCTGCTCGTCAAATACATATAAGTTACCTGATTACTGCCACAAGTATTCAGTTTCGAACGCGGCTTTGAGCGGCTTTGAATGTCGCCCTTTAAT

Full Affymetrix probeset data:

Annotations for 1624381_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime