FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624384_at:

>probe:Drosophila_2:1624384_at:474:385; Interrogation_Position=113; Antisense; GAACACCCGGCAATCAAGTCTACAT
>probe:Drosophila_2:1624384_at:727:61; Interrogation_Position=13; Antisense; ATGGTCTCGCCCAAACGGAGACTAA
>probe:Drosophila_2:1624384_at:1:91; Interrogation_Position=174; Antisense; AGTAGGTGGTCAGTTCCATCACGCA
>probe:Drosophila_2:1624384_at:684:633; Interrogation_Position=202; Antisense; TCGCCAGCAGATCACGTCTATACGG
>probe:Drosophila_2:1624384_at:588:75; Interrogation_Position=243; Antisense; AGGACCAGGTCTAGCTGCTGTACAG
>probe:Drosophila_2:1624384_at:86:637; Interrogation_Position=300; Antisense; TCGCAATCCCCAGTTTCATGTGGAG
>probe:Drosophila_2:1624384_at:484:145; Interrogation_Position=33; Antisense; ACTAATCGACGATTCCATTGCTCCC
>probe:Drosophila_2:1624384_at:387:549; Interrogation_Position=355; Antisense; GGAGGATTTGTCGTCCAAAGGAGCA
>probe:Drosophila_2:1624384_at:409:103; Interrogation_Position=379; Antisense; AGACGTAGTCCTCAGTTCCATGTGG
>probe:Drosophila_2:1624384_at:112:677; Interrogation_Position=465; Antisense; TAGTCCCCAGTTTCCTGTGGAGCGA
>probe:Drosophila_2:1624384_at:410:719; Interrogation_Position=476; Antisense; TTCCTGTGGAGCGACCTTGGCAAAG
>probe:Drosophila_2:1624384_at:558:451; Interrogation_Position=67; Antisense; GATCTCCAGCGGACATACGACGGAC
>probe:Drosophila_2:1624384_at:506:27; Interrogation_Position=81; Antisense; ATACGACGGACATGATGGGCCTCAC
>probe:Drosophila_2:1624384_at:295:607; Interrogation_Position=93; Antisense; TGATGGGCCTCACGTTTTCGGAACA

Paste this into a BLAST search page for me
GAACACCCGGCAATCAAGTCTACATATGGTCTCGCCCAAACGGAGACTAAAGTAGGTGGTCAGTTCCATCACGCATCGCCAGCAGATCACGTCTATACGGAGGACCAGGTCTAGCTGCTGTACAGTCGCAATCCCCAGTTTCATGTGGAGACTAATCGACGATTCCATTGCTCCCGGAGGATTTGTCGTCCAAAGGAGCAAGACGTAGTCCTCAGTTCCATGTGGTAGTCCCCAGTTTCCTGTGGAGCGATTCCTGTGGAGCGACCTTGGCAAAGGATCTCCAGCGGACATACGACGGACATACGACGGACATGATGGGCCTCACTGATGGGCCTCACGTTTTCGGAACA

Full Affymetrix probeset data:

Annotations for 1624384_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720