FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624385_at:

>probe:Drosophila_2:1624385_at:90:717; Interrogation_Position=6887; Antisense; TTCCCAAGCTCCTTAAATTTTTCAT
>probe:Drosophila_2:1624385_at:344:245; Interrogation_Position=6902; Antisense; AATTTTTCATTTTGGCAAGCGCGTG
>probe:Drosophila_2:1624385_at:720:565; Interrogation_Position=6915; Antisense; GGCAAGCGCGTGTCATACTAAATTT
>probe:Drosophila_2:1624385_at:399:191; Interrogation_Position=6997; Antisense; AACGGAAACACGGATAACATCGAGA
>probe:Drosophila_2:1624385_at:40:439; Interrogation_Position=7033; Antisense; GATGGACCTCTCACACAAAATGTTA
>probe:Drosophila_2:1624385_at:318:31; Interrogation_Position=7095; Antisense; ATAAAAGACCATTTGTCCACCCATA
>probe:Drosophila_2:1624385_at:670:503; Interrogation_Position=7109; Antisense; GTCCACCCATAAACGCACAAAGCGG
>probe:Drosophila_2:1624385_at:375:477; Interrogation_Position=7133; Antisense; GTATATTTGTCGATTAGGGCTTTGC
>probe:Drosophila_2:1624385_at:166:83; Interrogation_Position=7148; Antisense; AGGGCTTTGCATTCGTTCTAGTTAA
>probe:Drosophila_2:1624385_at:7:603; Interrogation_Position=7176; Antisense; TGTTTAGTTTGCTTTTCCCATTCTT
>probe:Drosophila_2:1624385_at:35:697; Interrogation_Position=7189; Antisense; TTTCCCATTCTTATTATCCTCAAGC
>probe:Drosophila_2:1624385_at:566:47; Interrogation_Position=7204; Antisense; ATCCTCAAGCAAATTCTAACTCATA
>probe:Drosophila_2:1624385_at:653:383; Interrogation_Position=7277; Antisense; GAACTATTTCTCTGGCGTTTAACTA
>probe:Drosophila_2:1624385_at:216:345; Interrogation_Position=7321; Antisense; GCATACAATGTGCATAAACGCTTAT

Paste this into a BLAST search page for me
TTCCCAAGCTCCTTAAATTTTTCATAATTTTTCATTTTGGCAAGCGCGTGGGCAAGCGCGTGTCATACTAAATTTAACGGAAACACGGATAACATCGAGAGATGGACCTCTCACACAAAATGTTAATAAAAGACCATTTGTCCACCCATAGTCCACCCATAAACGCACAAAGCGGGTATATTTGTCGATTAGGGCTTTGCAGGGCTTTGCATTCGTTCTAGTTAATGTTTAGTTTGCTTTTCCCATTCTTTTTCCCATTCTTATTATCCTCAAGCATCCTCAAGCAAATTCTAACTCATAGAACTATTTCTCTGGCGTTTAACTAGCATACAATGTGCATAAACGCTTAT

Full Affymetrix probeset data:

Annotations for 1624385_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720