FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624386_at:

>probe:Drosophila_2:1624386_at:644:235; Interrogation_Position=1433; Antisense; AATCGCGCGCTAATCCAGTACTTTA
>probe:Drosophila_2:1624386_at:154:707; Interrogation_Position=1455; Antisense; TTAGCCCCTATATGTCAGCTGATAT
>probe:Drosophila_2:1624386_at:684:67; Interrogation_Position=1487; Antisense; ATGGCCATGGCATTTAACTCGTCGG
>probe:Drosophila_2:1624386_at:571:675; Interrogation_Position=1548; Antisense; TAGACGGACAGATCCAGGCGCGTAT
>probe:Drosophila_2:1624386_at:600:69; Interrogation_Position=1563; Antisense; AGGCGCGTATTGACTCCCACAATAA
>probe:Drosophila_2:1624386_at:133:655; Interrogation_Position=1585; Antisense; TAAGATCCTGTTCGCCAAGGAGGCG
>probe:Drosophila_2:1624386_at:205:73; Interrogation_Position=1616; Antisense; AGGAACAGCACCTTTGAGCGGGCTT
>probe:Drosophila_2:1624386_at:525:725; Interrogation_Position=1629; Antisense; TTGAGCGGGCTTTGATCATGGGCAA
>probe:Drosophila_2:1624386_at:655:63; Interrogation_Position=1646; Antisense; ATGGGCAAGCAGTACCAGCGTCATA
>probe:Drosophila_2:1624386_at:376:53; Interrogation_Position=1676; Antisense; ATGCTTGTTCTTCGTGCTGCAATGC
>probe:Drosophila_2:1624386_at:345:53; Interrogation_Position=1697; Antisense; ATGCTCAAGAGCCACATCCACGTGA
>probe:Drosophila_2:1624386_at:707:45; Interrogation_Position=1712; Antisense; ATCCACGTGAAGAGCATTTCCCGGG
>probe:Drosophila_2:1624386_at:88:653; Interrogation_Position=1795; Antisense; TCAACTCGCCCGAATCTAGAGCAAT
>probe:Drosophila_2:1624386_at:555:111; Interrogation_Position=1945; Antisense; AGCACCATACTTCATCGTGTAAATG

Paste this into a BLAST search page for me
AATCGCGCGCTAATCCAGTACTTTATTAGCCCCTATATGTCAGCTGATATATGGCCATGGCATTTAACTCGTCGGTAGACGGACAGATCCAGGCGCGTATAGGCGCGTATTGACTCCCACAATAATAAGATCCTGTTCGCCAAGGAGGCGAGGAACAGCACCTTTGAGCGGGCTTTTGAGCGGGCTTTGATCATGGGCAAATGGGCAAGCAGTACCAGCGTCATAATGCTTGTTCTTCGTGCTGCAATGCATGCTCAAGAGCCACATCCACGTGAATCCACGTGAAGAGCATTTCCCGGGTCAACTCGCCCGAATCTAGAGCAATAGCACCATACTTCATCGTGTAAATG

Full Affymetrix probeset data:

Annotations for 1624386_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720