Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624387_at:

>probe:Drosophila_2:1624387_at:190:245; Interrogation_Position=4128; Antisense; AATTGTCGGGAGATAAGCTTATGTA
>probe:Drosophila_2:1624387_at:124:485; Interrogation_Position=4155; Antisense; GTATGCTTGTACTTTATGCTGCCAT
>probe:Drosophila_2:1624387_at:115:457; Interrogation_Position=4185; Antisense; GATACTAACGATATCCACACGGGCC
>probe:Drosophila_2:1624387_at:546:303; Interrogation_Position=4210; Antisense; CCGACCTGGTCGAACTCTAAAGTAT
>probe:Drosophila_2:1624387_at:506:165; Interrogation_Position=4238; Antisense; AAATCTGTTGTTAATGGTTTGACGA
>probe:Drosophila_2:1624387_at:297:253; Interrogation_Position=4315; Antisense; CAAACTATCCCTGTTGCGGACAAAA
>probe:Drosophila_2:1624387_at:647:395; Interrogation_Position=4347; Antisense; GAAATACGAGCATATTCTGCAAAAA
>probe:Drosophila_2:1624387_at:70:421; Interrogation_Position=4375; Antisense; GAGCAAAAGCCCTTTGTACCTAGAA
>probe:Drosophila_2:1624387_at:723:599; Interrogation_Position=4389; Antisense; TGTACCTAGAAGTTGTTACCAATTA
>probe:Drosophila_2:1624387_at:379:409; Interrogation_Position=4468; Antisense; GACGAGATTTGCTTATCACATATGA
>probe:Drosophila_2:1624387_at:122:591; Interrogation_Position=4528; Antisense; TTTAAGACACTGCACACCTTTTTCT
>probe:Drosophila_2:1624387_at:2:259; Interrogation_Position=4540; Antisense; CACACCTTTTTCTTCTTACTCATTT
>probe:Drosophila_2:1624387_at:214:667; Interrogation_Position=4556; Antisense; TACTCATTTTGTATACACGTTTCAG
>probe:Drosophila_2:1624387_at:269:157; Interrogation_Position=4570; Antisense; ACACGTTTCAGTATTTATTTAGCAA

Paste this into a BLAST search page for me
AATTGTCGGGAGATAAGCTTATGTAGTATGCTTGTACTTTATGCTGCCATGATACTAACGATATCCACACGGGCCCCGACCTGGTCGAACTCTAAAGTATAAATCTGTTGTTAATGGTTTGACGACAAACTATCCCTGTTGCGGACAAAAGAAATACGAGCATATTCTGCAAAAAGAGCAAAAGCCCTTTGTACCTAGAATGTACCTAGAAGTTGTTACCAATTAGACGAGATTTGCTTATCACATATGATTTAAGACACTGCACACCTTTTTCTCACACCTTTTTCTTCTTACTCATTTTACTCATTTTGTATACACGTTTCAGACACGTTTCAGTATTTATTTAGCAA

Full Affymetrix probeset data:

Annotations for 1624387_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime