Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624389_at:

>probe:Drosophila_2:1624389_at:181:593; Interrogation_Position=3836; Antisense; TGGGTTCGGATACCTCCAACTATTG
>probe:Drosophila_2:1624389_at:271:691; Interrogation_Position=3856; Antisense; TATTGTCCTCCATCCATTGAAGTAT
>probe:Drosophila_2:1624389_at:642:657; Interrogation_Position=3957; Antisense; TAAGTCACATTTTCCGGGTTCTTTG
>probe:Drosophila_2:1624389_at:626:661; Interrogation_Position=3984; Antisense; TAAAGTCGGCGATCACGCAATCAAA
>probe:Drosophila_2:1624389_at:183:21; Interrogation_Position=4057; Antisense; ATATACGTCAGATCTGCCAAGCCCA
>probe:Drosophila_2:1624389_at:660:35; Interrogation_Position=4105; Antisense; ATCAGTTTTGATTCCGAGCCCGAAA
>probe:Drosophila_2:1624389_at:579:641; Interrogation_Position=4131; Antisense; TCTCTCCGATGTTTCACAAACCTAT
>probe:Drosophila_2:1624389_at:561:175; Interrogation_Position=4148; Antisense; AAACCTATGTGGTCTGTCCGGATAA
>probe:Drosophila_2:1624389_at:471:471; Interrogation_Position=4185; Antisense; GGTAACCGCCGAATCCGTAAGTCTG
>probe:Drosophila_2:1624389_at:437:319; Interrogation_Position=4209; Antisense; GCCCGTTGGTTGCACTCTGAAGAAT
>probe:Drosophila_2:1624389_at:381:333; Interrogation_Position=4263; Antisense; GCTGAAACGCGGCAAGCTCACTTCT
>probe:Drosophila_2:1624389_at:499:117; Interrogation_Position=4277; Antisense; AGCTCACTTCTCTTTGGCATCAGTA
>probe:Drosophila_2:1624389_at:488:491; Interrogation_Position=4331; Antisense; GTAATGCTTGATGCGCACTTTATAT
>probe:Drosophila_2:1624389_at:214:487; Interrogation_Position=4366; Antisense; GTACGACTTTTGTATGCCTGACATT

Paste this into a BLAST search page for me
TGGGTTCGGATACCTCCAACTATTGTATTGTCCTCCATCCATTGAAGTATTAAGTCACATTTTCCGGGTTCTTTGTAAAGTCGGCGATCACGCAATCAAAATATACGTCAGATCTGCCAAGCCCAATCAGTTTTGATTCCGAGCCCGAAATCTCTCCGATGTTTCACAAACCTATAAACCTATGTGGTCTGTCCGGATAAGGTAACCGCCGAATCCGTAAGTCTGGCCCGTTGGTTGCACTCTGAAGAATGCTGAAACGCGGCAAGCTCACTTCTAGCTCACTTCTCTTTGGCATCAGTAGTAATGCTTGATGCGCACTTTATATGTACGACTTTTGTATGCCTGACATT

Full Affymetrix probeset data:

Annotations for 1624389_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime