Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624390_a_at:

>probe:Drosophila_2:1624390_a_at:9:543; Interrogation_Position=438; Antisense; GGACCAACCGGACCGCAGTGAAACA
>probe:Drosophila_2:1624390_a_at:515:187; Interrogation_Position=459; Antisense; AACACAGCGACATATTGAGACCATT
>probe:Drosophila_2:1624390_a_at:17:215; Interrogation_Position=520; Antisense; AAGATGGAGCGCAAGTTTCAGAAAC
>probe:Drosophila_2:1624390_a_at:411:105; Interrogation_Position=539; Antisense; AGAAACGACGCAATGACTTCACTTT
>probe:Drosophila_2:1624390_a_at:364:403; Interrogation_Position=553; Antisense; GACTTCACTTTGCTGATGTACACGA
>probe:Drosophila_2:1624390_a_at:483:443; Interrogation_Position=567; Antisense; GATGTACACGATTCACGAGCTGGAA
>probe:Drosophila_2:1624390_a_at:383:281; Interrogation_Position=654; Antisense; CTCTGAGCCGGACCTAGACGACAAT
>probe:Drosophila_2:1624390_a_at:301:137; Interrogation_Position=704; Antisense; ACGACGATCTCAACAATAGCACTCC
>probe:Drosophila_2:1624390_a_at:250:23; Interrogation_Position=719; Antisense; ATAGCACTCCCACAAAGTTCGACGG
>probe:Drosophila_2:1624390_a_at:259:417; Interrogation_Position=754; Antisense; GAGCCCAAATATCACTCAGTCTCTA
>probe:Drosophila_2:1624390_a_at:41:557; Interrogation_Position=783; Antisense; GGACTCTAAAGCCATGTCCGTAGAA
>probe:Drosophila_2:1624390_a_at:94:99; Interrogation_Position=807; Antisense; AGAGGACACGGTGCTTGAGCTAAGC
>probe:Drosophila_2:1624390_a_at:141:137; Interrogation_Position=848; Antisense; ACGACGTGGATGTAGCTGTTGCCAA
>probe:Drosophila_2:1624390_a_at:284:541; Interrogation_Position=876; Antisense; GGTTAGAAGCGCTAGCATGTACAAT

Paste this into a BLAST search page for me
GGACCAACCGGACCGCAGTGAAACAAACACAGCGACATATTGAGACCATTAAGATGGAGCGCAAGTTTCAGAAACAGAAACGACGCAATGACTTCACTTTGACTTCACTTTGCTGATGTACACGAGATGTACACGATTCACGAGCTGGAACTCTGAGCCGGACCTAGACGACAATACGACGATCTCAACAATAGCACTCCATAGCACTCCCACAAAGTTCGACGGGAGCCCAAATATCACTCAGTCTCTAGGACTCTAAAGCCATGTCCGTAGAAAGAGGACACGGTGCTTGAGCTAAGCACGACGTGGATGTAGCTGTTGCCAAGGTTAGAAGCGCTAGCATGTACAAT

Full Affymetrix probeset data:

Annotations for 1624390_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime