Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624393_at:

>probe:Drosophila_2:1624393_at:285:537; Interrogation_Position=1814; Antisense; GGTCACTCTGGTGGCCAATGTGTCA
>probe:Drosophila_2:1624393_at:109:251; Interrogation_Position=1829; Antisense; CAATGTGTCAACGTCCTTCGGATAT
>probe:Drosophila_2:1624393_at:11:545; Interrogation_Position=1848; Antisense; GGATATCTAATATCCTGCGCCAGCT
>probe:Drosophila_2:1624393_at:531:475; Interrogation_Position=1908; Antisense; GTTATCATACCATTCCTGCTCTTTG
>probe:Drosophila_2:1624393_at:564:727; Interrogation_Position=1930; Antisense; TTGGCGGCTTCTTCTTGAACTCGGG
>probe:Drosophila_2:1624393_at:567:337; Interrogation_Position=1954; Antisense; GCTCGGTGCCAGTATACCTCAAATG
>probe:Drosophila_2:1624393_at:293:169; Interrogation_Position=1974; Antisense; AAATGGTTGTCGTACCTCTCATGGT
>probe:Drosophila_2:1624393_at:664:473; Interrogation_Position=2002; Antisense; GTTACGCCAACGAGGGTCTGCTGAT
>probe:Drosophila_2:1624393_at:317:499; Interrogation_Position=2017; Antisense; GTCTGCTGATTAACCAATGGGCGGA
>probe:Drosophila_2:1624393_at:641:415; Interrogation_Position=2046; Antisense; GAGCCGGGCGAAATTAGCTGCACAT
>probe:Drosophila_2:1624393_at:31:567; Interrogation_Position=2097; Antisense; GGCAAGGTCATCCTGGAGACGCTTA
>probe:Drosophila_2:1624393_at:386:535; Interrogation_Position=2186; Antisense; GGTGCTCGCATATCTGGCTCTAAGA
>probe:Drosophila_2:1624393_at:253:429; Interrogation_Position=2229; Antisense; GAGTAGCCGACATATATCCGAAATA
>probe:Drosophila_2:1624393_at:544:269; Interrogation_Position=2284; Antisense; CATCGTGTTTACTGTTTATTGCCCC

Paste this into a BLAST search page for me
GGTCACTCTGGTGGCCAATGTGTCACAATGTGTCAACGTCCTTCGGATATGGATATCTAATATCCTGCGCCAGCTGTTATCATACCATTCCTGCTCTTTGTTGGCGGCTTCTTCTTGAACTCGGGGCTCGGTGCCAGTATACCTCAAATGAAATGGTTGTCGTACCTCTCATGGTGTTACGCCAACGAGGGTCTGCTGATGTCTGCTGATTAACCAATGGGCGGAGAGCCGGGCGAAATTAGCTGCACATGGCAAGGTCATCCTGGAGACGCTTAGGTGCTCGCATATCTGGCTCTAAGAGAGTAGCCGACATATATCCGAAATACATCGTGTTTACTGTTTATTGCCCC

Full Affymetrix probeset data:

Annotations for 1624393_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime