Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624394_at:

>probe:Drosophila_2:1624394_at:573:587; Interrogation_Position=114; Antisense; TGGAGCCTCGGATCTGCTGCGCCAT
>probe:Drosophila_2:1624394_at:499:59; Interrogation_Position=13; Antisense; ATGTCCACCGACGAGGATTCCCTGG
>probe:Drosophila_2:1624394_at:113:323; Interrogation_Position=132; Antisense; GCGCCATCAGCAGAGCTTTGAGGCT
>probe:Drosophila_2:1624394_at:218:727; Interrogation_Position=149; Antisense; TTGAGGCTCGCTACAGCGGGATCAT
>probe:Drosophila_2:1624394_at:647:121; Interrogation_Position=163; Antisense; AGCGGGATCATCCAGAAGCAAATCT
>probe:Drosophila_2:1624394_at:471:357; Interrogation_Position=180; Antisense; GCAAATCTGGGAGACGAGCATCAAC
>probe:Drosophila_2:1624394_at:115:225; Interrogation_Position=205; Antisense; AAGGATGTGCTGGAACGTCAGCTAA
>probe:Drosophila_2:1624394_at:545:639; Interrogation_Position=222; Antisense; TCAGCTAAATGCGTACTTCCCTTTC
>probe:Drosophila_2:1624394_at:723:577; Interrogation_Position=263; Antisense; TGACCAAGGACGCATCCGGCGGATT
>probe:Drosophila_2:1624394_at:678:287; Interrogation_Position=279; Antisense; CGGCGGATTCGATCAGCTCCTGGCG
>probe:Drosophila_2:1624394_at:400:81; Interrogation_Position=313; Antisense; AGTGGAACTGGTCCGAAGTCTCGAT
>probe:Drosophila_2:1624394_at:331:311; Interrogation_Position=406; Antisense; GCCTCCCTCGATCAACAGAAGCAAG
>probe:Drosophila_2:1624394_at:312:201; Interrogation_Position=80; Antisense; AACCGACGCGAGAACGCCATCGAGG
>probe:Drosophila_2:1624394_at:478:43; Interrogation_Position=98; Antisense; ATCGAGGCGGTCGATCTGGAGCCTC

Paste this into a BLAST search page for me
TGGAGCCTCGGATCTGCTGCGCCATATGTCCACCGACGAGGATTCCCTGGGCGCCATCAGCAGAGCTTTGAGGCTTTGAGGCTCGCTACAGCGGGATCATAGCGGGATCATCCAGAAGCAAATCTGCAAATCTGGGAGACGAGCATCAACAAGGATGTGCTGGAACGTCAGCTAATCAGCTAAATGCGTACTTCCCTTTCTGACCAAGGACGCATCCGGCGGATTCGGCGGATTCGATCAGCTCCTGGCGAGTGGAACTGGTCCGAAGTCTCGATGCCTCCCTCGATCAACAGAAGCAAGAACCGACGCGAGAACGCCATCGAGGATCGAGGCGGTCGATCTGGAGCCTC

Full Affymetrix probeset data:

Annotations for 1624394_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime