Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624395_at:

>probe:Drosophila_2:1624395_at:335:287; Interrogation_Position=1185; Antisense; CGGCTCAGGATCTTTGGGAACTCAT
>probe:Drosophila_2:1624395_at:385:527; Interrogation_Position=1200; Antisense; GGGAACTCATCATATGTTCGGCACG
>probe:Drosophila_2:1624395_at:19:473; Interrogation_Position=1215; Antisense; GTTCGGCACGGCATAGTATACGAAT
>probe:Drosophila_2:1624395_at:672:73; Interrogation_Position=1262; Antisense; AGGATATACCACACACACCTAGTGC
>probe:Drosophila_2:1624395_at:272:87; Interrogation_Position=1282; Antisense; AGTGCGCTGCCTAAAGATCCTAAAA
>probe:Drosophila_2:1624395_at:129:135; Interrogation_Position=1388; Antisense; ACGCACCTTGTGTTCATTTTGCTGC
>probe:Drosophila_2:1624395_at:127:17; Interrogation_Position=1403; Antisense; ATTTTGCTGCCACCGGATACGGAAG
>probe:Drosophila_2:1624395_at:221:275; Interrogation_Position=1432; Antisense; CTTGGTGAAGCTTACGCAGCCGGGA
>probe:Drosophila_2:1624395_at:369:225; Interrogation_Position=1461; Antisense; AAGGAGATCGCTTCCGGTCCAAGGT
>probe:Drosophila_2:1624395_at:321:81; Interrogation_Position=1482; Antisense; AGGTGTACACAAATCCACTCTACGT
>probe:Drosophila_2:1624395_at:591:11; Interrogation_Position=1523; Antisense; ATATTCCCCTTTCTACTTCGGCGTG
>probe:Drosophila_2:1624395_at:463:275; Interrogation_Position=1538; Antisense; CTTCGGCGTGGTATTCTAGACTTTT
>probe:Drosophila_2:1624395_at:170:379; Interrogation_Position=1563; Antisense; GAAGCGGTTCAAGTCATTACTGTTA
>probe:Drosophila_2:1624395_at:283:653; Interrogation_Position=1672; Antisense; TATCCCGTTTGGACTGTAACTTCTT

Paste this into a BLAST search page for me
CGGCTCAGGATCTTTGGGAACTCATGGGAACTCATCATATGTTCGGCACGGTTCGGCACGGCATAGTATACGAATAGGATATACCACACACACCTAGTGCAGTGCGCTGCCTAAAGATCCTAAAAACGCACCTTGTGTTCATTTTGCTGCATTTTGCTGCCACCGGATACGGAAGCTTGGTGAAGCTTACGCAGCCGGGAAAGGAGATCGCTTCCGGTCCAAGGTAGGTGTACACAAATCCACTCTACGTATATTCCCCTTTCTACTTCGGCGTGCTTCGGCGTGGTATTCTAGACTTTTGAAGCGGTTCAAGTCATTACTGTTATATCCCGTTTGGACTGTAACTTCTT

Full Affymetrix probeset data:

Annotations for 1624395_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime