Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624396_at:

>probe:Drosophila_2:1624396_at:570:15; Interrogation_Position=1923; Antisense; ATTATGACCTATGATCCACTGCCGC
>probe:Drosophila_2:1624396_at:604:381; Interrogation_Position=1952; Antisense; GAACAGCGTCAACTGCTATCATCGA
>probe:Drosophila_2:1624396_at:647:515; Interrogation_Position=2022; Antisense; GTGTCAATGTTCTTTCAATCGCTCT
>probe:Drosophila_2:1624396_at:636:297; Interrogation_Position=2041; Antisense; CGCTCTTGCCTTCGTTTAACATTAA
>probe:Drosophila_2:1624396_at:409:135; Interrogation_Position=2233; Antisense; ACGCGATGCGAGACTTCCTGCAAAA
>probe:Drosophila_2:1624396_at:667:181; Interrogation_Position=2254; Antisense; AAAACTTCCGGATTGCAGAGCACTT
>probe:Drosophila_2:1624396_at:396:101; Interrogation_Position=2270; Antisense; AGAGCACTTGCGTTCGCCGGAAACG
>probe:Drosophila_2:1624396_at:585:177; Interrogation_Position=2290; Antisense; AAACGGCGGCGGCACAATCCACGAG
>probe:Drosophila_2:1624396_at:400:549; Interrogation_Position=2330; Antisense; GGAGGGCTCCAGTGACTACATTGAC
>probe:Drosophila_2:1624396_at:344:647; Interrogation_Position=2358; Antisense; TCAGTTTGTCAATTACGCGAGGCGT
>probe:Drosophila_2:1624396_at:543:467; Interrogation_Position=2389; Antisense; GTTGTTTCGGATTTCTAGCTCGGGA
>probe:Drosophila_2:1624396_at:439:277; Interrogation_Position=2403; Antisense; CTAGCTCGGGACATGTTTTTTGGAA
>probe:Drosophila_2:1624396_at:47:173; Interrogation_Position=2426; Antisense; AAACCACCTTTTGCTATTTTCTCAG
>probe:Drosophila_2:1624396_at:369:689; Interrogation_Position=2440; Antisense; TATTTTCTCAGCTTAGCGACACCGT

Paste this into a BLAST search page for me
ATTATGACCTATGATCCACTGCCGCGAACAGCGTCAACTGCTATCATCGAGTGTCAATGTTCTTTCAATCGCTCTCGCTCTTGCCTTCGTTTAACATTAAACGCGATGCGAGACTTCCTGCAAAAAAAACTTCCGGATTGCAGAGCACTTAGAGCACTTGCGTTCGCCGGAAACGAAACGGCGGCGGCACAATCCACGAGGGAGGGCTCCAGTGACTACATTGACTCAGTTTGTCAATTACGCGAGGCGTGTTGTTTCGGATTTCTAGCTCGGGACTAGCTCGGGACATGTTTTTTGGAAAAACCACCTTTTGCTATTTTCTCAGTATTTTCTCAGCTTAGCGACACCGT

Full Affymetrix probeset data:

Annotations for 1624396_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime