Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624398_at:

>probe:Drosophila_2:1624398_at:413:627; Interrogation_Position=1657; Antisense; TGCCACATCGGGTCTTCAGTATTTA
>probe:Drosophila_2:1624398_at:258:689; Interrogation_Position=1686; Antisense; TATTAATTGCCTATTCTCCGTACTG
>probe:Drosophila_2:1624398_at:680:669; Interrogation_Position=1706; Antisense; TACTGCCTGTGCATCTGAGTGGTGG
>probe:Drosophila_2:1624398_at:305:433; Interrogation_Position=1722; Antisense; GAGTGGTGGCTGTAAACTGCAAACT
>probe:Drosophila_2:1624398_at:485:719; Interrogation_Position=1769; Antisense; TTCCGATCGTGGGACCTGGTATGAT
>probe:Drosophila_2:1624398_at:633:461; Interrogation_Position=1864; Antisense; GATTAGTCAATGCAACTCGTTCGCA
>probe:Drosophila_2:1624398_at:708:281; Interrogation_Position=1879; Antisense; CTCGTTCGCAGCAACAGAGTGTTAA
>probe:Drosophila_2:1624398_at:413:665; Interrogation_Position=1921; Antisense; TACACAATCCCAATCTCGCACTTGT
>probe:Drosophila_2:1624398_at:615:543; Interrogation_Position=1953; Antisense; GGATAATGAACACATCTGCCACCCT
>probe:Drosophila_2:1624398_at:156:483; Interrogation_Position=2025; Antisense; GTATATTTACGCAAGAGGTTCTAGA
>probe:Drosophila_2:1624398_at:680:121; Interrogation_Position=2054; Antisense; AGCGTACCTGCTAAGATCTATTTTA
>probe:Drosophila_2:1624398_at:170:115; Interrogation_Position=2079; Antisense; AGCATCGACTTTTATGTGTGTGTAC
>probe:Drosophila_2:1624398_at:112:483; Interrogation_Position=2131; Antisense; GTATATTTCGATCCAACTATTGTTG
>probe:Drosophila_2:1624398_at:143:543; Interrogation_Position=2221; Antisense; GGATGAAATACGCAATACTTCTCAA

Paste this into a BLAST search page for me
TGCCACATCGGGTCTTCAGTATTTATATTAATTGCCTATTCTCCGTACTGTACTGCCTGTGCATCTGAGTGGTGGGAGTGGTGGCTGTAAACTGCAAACTTTCCGATCGTGGGACCTGGTATGATGATTAGTCAATGCAACTCGTTCGCACTCGTTCGCAGCAACAGAGTGTTAATACACAATCCCAATCTCGCACTTGTGGATAATGAACACATCTGCCACCCTGTATATTTACGCAAGAGGTTCTAGAAGCGTACCTGCTAAGATCTATTTTAAGCATCGACTTTTATGTGTGTGTACGTATATTTCGATCCAACTATTGTTGGGATGAAATACGCAATACTTCTCAA

Full Affymetrix probeset data:

Annotations for 1624398_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime