Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624400_a_at:

>probe:Drosophila_2:1624400_a_at:126:269; Interrogation_Position=1002; Antisense; CAGGAATCTCCTGAACATTTTGTTT
>probe:Drosophila_2:1624400_a_at:512:217; Interrogation_Position=1075; Antisense; AAGTACTTTGTCGATCCGCCGCAGG
>probe:Drosophila_2:1624400_a_at:314:297; Interrogation_Position=1094; Antisense; CGCAGGCTTGTGACCCGGGCATGAT
>probe:Drosophila_2:1624400_a_at:482:9; Interrogation_Position=1183; Antisense; ATTCCCATCTCGGATTTACTCAATG
>probe:Drosophila_2:1624400_a_at:190:587; Interrogation_Position=660; Antisense; TGGACTGGCCCGCATGTTTAGCAAT
>probe:Drosophila_2:1624400_a_at:633:431; Interrogation_Position=708; Antisense; GATGGTTACTTTGTGGTACCGGGCA
>probe:Drosophila_2:1624400_a_at:245:131; Interrogation_Position=732; Antisense; ACCTGAACTTCTTTTGGGATGCCGA
>probe:Drosophila_2:1624400_a_at:578:691; Interrogation_Position=787; Antisense; TTTGGCTGCATTCTTGGTGAGCTGC
>probe:Drosophila_2:1624400_a_at:539:607; Interrogation_Position=804; Antisense; TGAGCTGCTGCTCGGAAAACCTTTG
>probe:Drosophila_2:1624400_a_at:225:25; Interrogation_Position=847; Antisense; ATAGCACAGCTGGACATGATCATCG
>probe:Drosophila_2:1624400_a_at:548:453; Interrogation_Position=864; Antisense; GATCATCGATCTCTTGGGAGCTCCA
>probe:Drosophila_2:1624400_a_at:702:41; Interrogation_Position=888; Antisense; ATCGGAGTCCATTTGGCCTGGCTTT
>probe:Drosophila_2:1624400_a_at:235:701; Interrogation_Position=936; Antisense; TTTTACCTTAAGTCAGCAGCCCTAC
>probe:Drosophila_2:1624400_a_at:320:203; Interrogation_Position=964; Antisense; AACCTTACGCCGAAGTTTCACATGA

Paste this into a BLAST search page for me
CAGGAATCTCCTGAACATTTTGTTTAAGTACTTTGTCGATCCGCCGCAGGCGCAGGCTTGTGACCCGGGCATGATATTCCCATCTCGGATTTACTCAATGTGGACTGGCCCGCATGTTTAGCAATGATGGTTACTTTGTGGTACCGGGCAACCTGAACTTCTTTTGGGATGCCGATTTGGCTGCATTCTTGGTGAGCTGCTGAGCTGCTGCTCGGAAAACCTTTGATAGCACAGCTGGACATGATCATCGGATCATCGATCTCTTGGGAGCTCCAATCGGAGTCCATTTGGCCTGGCTTTTTTTACCTTAAGTCAGCAGCCCTACAACCTTACGCCGAAGTTTCACATGA

Full Affymetrix probeset data:

Annotations for 1624400_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime