FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624402_at:

>probe:Drosophila_2:1624402_at:76:515; Interrogation_Position=267; Antisense; GTGTCTATTTACCTGCACTTACGGG
>probe:Drosophila_2:1624402_at:417:239; Interrogation_Position=319; Antisense; AATCAATCTTATTTTGCTCCCGGAC
>probe:Drosophila_2:1624402_at:483:683; Interrogation_Position=392; Antisense; TATCCATGTTGATTACCACCGTCTT
>probe:Drosophila_2:1624402_at:595:497; Interrogation_Position=412; Antisense; GTCTTCTGGGCAGCTCTATCATTAA
>probe:Drosophila_2:1624402_at:250:521; Interrogation_Position=448; Antisense; GTGGCAGGTGAGCTTTACAACTTGT
>probe:Drosophila_2:1624402_at:403:159; Interrogation_Position=464; Antisense; ACAACTTGTGGTGCCATGCATTCAA
>probe:Drosophila_2:1624402_at:544:11; Interrogation_Position=483; Antisense; ATTCAACTCGATCTGCATGGTCTTC
>probe:Drosophila_2:1624402_at:155:405; Interrogation_Position=508; Antisense; GACTGCTTTATGGTGGCTTATCCTA
>probe:Drosophila_2:1624402_at:348:705; Interrogation_Position=525; Antisense; TTATCCTAACCGTCTTATGCACTTT
>probe:Drosophila_2:1624402_at:568:53; Interrogation_Position=541; Antisense; ATGCACTTTGTGTATCCCTTTTCGG
>probe:Drosophila_2:1624402_at:399:699; Interrogation_Position=559; Antisense; TTTTCGGTGGTGCTCATATTCTTGA
>probe:Drosophila_2:1624402_at:301:607; Interrogation_Position=581; Antisense; TGATGCATTCCCTTATTTACTATTG
>probe:Drosophila_2:1624402_at:517:301; Interrogation_Position=722; Antisense; CCCTCGTGGCCTTTGGAATTTACAG
>probe:Drosophila_2:1624402_at:190:173; Interrogation_Position=805; Antisense; AAAGCTACGCCCAATGAATCATCTC

Paste this into a BLAST search page for me
GTGTCTATTTACCTGCACTTACGGGAATCAATCTTATTTTGCTCCCGGACTATCCATGTTGATTACCACCGTCTTGTCTTCTGGGCAGCTCTATCATTAAGTGGCAGGTGAGCTTTACAACTTGTACAACTTGTGGTGCCATGCATTCAAATTCAACTCGATCTGCATGGTCTTCGACTGCTTTATGGTGGCTTATCCTATTATCCTAACCGTCTTATGCACTTTATGCACTTTGTGTATCCCTTTTCGGTTTTCGGTGGTGCTCATATTCTTGATGATGCATTCCCTTATTTACTATTGCCCTCGTGGCCTTTGGAATTTACAGAAAGCTACGCCCAATGAATCATCTC

Full Affymetrix probeset data:

Annotations for 1624402_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720