FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624403_at:

>probe:Drosophila_2:1624403_at:252:533; Interrogation_Position=105; Antisense; GGGTGGGCAACTGCAGCCAGTCACT
>probe:Drosophila_2:1624403_at:601:89; Interrogation_Position=123; Antisense; AGTCACTCACCTAAGCTCAGGGAAA
>probe:Drosophila_2:1624403_at:201:719; Interrogation_Position=156; Antisense; TTCCGCGTCCGCTAAGATTTCAAAG
>probe:Drosophila_2:1624403_at:20:405; Interrogation_Position=182; Antisense; GACTCTTGGGTTTTGAATATCTGAC
>probe:Drosophila_2:1624403_at:511:641; Interrogation_Position=201; Antisense; TCTGACCAAGGTCGCGCGATTGCTG
>probe:Drosophila_2:1624403_at:416:7; Interrogation_Position=27; Antisense; ATTGCAATTGCCAGCGGAACTCGTT
>probe:Drosophila_2:1624403_at:527:175; Interrogation_Position=286; Antisense; AAACCATCTTTTGGCAGCTTCTCAA
>probe:Drosophila_2:1624403_at:270:115; Interrogation_Position=301; Antisense; AGCTTCTCAACGAGTTCCACTTTGA
>probe:Drosophila_2:1624403_at:254:629; Interrogation_Position=316; Antisense; TCCACTTTGAGTTTTGCGTTCCAGA
>probe:Drosophila_2:1624403_at:430:59; Interrogation_Position=370; Antisense; ATGTTCAAGCTGTTCGTATTCCTCG
>probe:Drosophila_2:1624403_at:492:715; Interrogation_Position=397; Antisense; TTCTGTCTGGCTTTGAGCTATGCCG
>probe:Drosophila_2:1624403_at:76:507; Interrogation_Position=481; Antisense; GTGCGCGTGATCCAGCCCATTTGGA
>probe:Drosophila_2:1624403_at:294:597; Interrogation_Position=522; Antisense; TGTGCATCCCATCAGCTACGGAGGA
>probe:Drosophila_2:1624403_at:107:287; Interrogation_Position=80; Antisense; CGGATGGTCTGATGCAATTTTCGGT

Paste this into a BLAST search page for me
GGGTGGGCAACTGCAGCCAGTCACTAGTCACTCACCTAAGCTCAGGGAAATTCCGCGTCCGCTAAGATTTCAAAGGACTCTTGGGTTTTGAATATCTGACTCTGACCAAGGTCGCGCGATTGCTGATTGCAATTGCCAGCGGAACTCGTTAAACCATCTTTTGGCAGCTTCTCAAAGCTTCTCAACGAGTTCCACTTTGATCCACTTTGAGTTTTGCGTTCCAGAATGTTCAAGCTGTTCGTATTCCTCGTTCTGTCTGGCTTTGAGCTATGCCGGTGCGCGTGATCCAGCCCATTTGGATGTGCATCCCATCAGCTACGGAGGACGGATGGTCTGATGCAATTTTCGGT

Full Affymetrix probeset data:

Annotations for 1624403_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720