Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624406_at:

>probe:Drosophila_2:1624406_at:572:77; Interrogation_Position=1071; Antisense; AGGTTCCTGGCTGGGTGGATACCAA
>probe:Drosophila_2:1624406_at:467:519; Interrogation_Position=1085; Antisense; GTGGATACCAACAACTGTCAGCTTT
>probe:Drosophila_2:1624406_at:318:287; Interrogation_Position=1126; Antisense; CTGGAACTTCCGCTCAATGATGGAT
>probe:Drosophila_2:1624406_at:347:175; Interrogation_Position=1196; Antisense; AAAGCCGTGTGCGACAACTGTTCCA
>probe:Drosophila_2:1624406_at:639:193; Interrogation_Position=1211; Antisense; AACTGTTCCACCAATCGCATTAACA
>probe:Drosophila_2:1624406_at:408:569; Interrogation_Position=1247; Antisense; GGCTTCGAGTTTGATGTGCGTACCT
>probe:Drosophila_2:1624406_at:202:329; Interrogation_Position=1264; Antisense; GCGTACCTGTGATCCGTGCTACAAA
>probe:Drosophila_2:1624406_at:475:311; Interrogation_Position=1334; Antisense; GCCAAGCATTCGATCGTCTACATGG
>probe:Drosophila_2:1624406_at:563:173; Interrogation_Position=1375; Antisense; AAAGCGCCTGTTGACAGTGGGCCAG
>probe:Drosophila_2:1624406_at:567:545; Interrogation_Position=1420; Antisense; GGATCTCTCCAACATCTGGGCATAA
>probe:Drosophila_2:1624406_at:313:31; Interrogation_Position=1441; Antisense; ATAAAACATCCTGTACGCACACGCA
>probe:Drosophila_2:1624406_at:357:237; Interrogation_Position=1480; Antisense; AATCATTCACGAGGCGTTTCGGTCT
>probe:Drosophila_2:1624406_at:265:383; Interrogation_Position=1526; Antisense; GAACGATGTGGCTGGCAACGACCAA
>probe:Drosophila_2:1624406_at:625:87; Interrogation_Position=1555; Antisense; AGTCCCTGCTGCTTAGGTTCTCATA

Paste this into a BLAST search page for me
AGGTTCCTGGCTGGGTGGATACCAAGTGGATACCAACAACTGTCAGCTTTCTGGAACTTCCGCTCAATGATGGATAAAGCCGTGTGCGACAACTGTTCCAAACTGTTCCACCAATCGCATTAACAGGCTTCGAGTTTGATGTGCGTACCTGCGTACCTGTGATCCGTGCTACAAAGCCAAGCATTCGATCGTCTACATGGAAAGCGCCTGTTGACAGTGGGCCAGGGATCTCTCCAACATCTGGGCATAAATAAAACATCCTGTACGCACACGCAAATCATTCACGAGGCGTTTCGGTCTGAACGATGTGGCTGGCAACGACCAAAGTCCCTGCTGCTTAGGTTCTCATA

Full Affymetrix probeset data:

Annotations for 1624406_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime