Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624408_at:

>probe:Drosophila_2:1624408_at:537:539; Interrogation_Position=2683; Antisense; GGTTACCTGGGCATCGGACCGCACT
>probe:Drosophila_2:1624408_at:403:555; Interrogation_Position=2698; Antisense; GGACCGCACTCGATCGTAATCGAAT
>probe:Drosophila_2:1624408_at:39:485; Interrogation_Position=2736; Antisense; GTATCGACGCATGAAGCGCTTCCAA
>probe:Drosophila_2:1624408_at:191:343; Interrogation_Position=2753; Antisense; GCTTCCAACGGAGAGCGCGTACTTG
>probe:Drosophila_2:1624408_at:75:103; Interrogation_Position=2764; Antisense; AGAGCGCGTACTTGCGCGTAATCCT
>probe:Drosophila_2:1624408_at:399:327; Interrogation_Position=2779; Antisense; GCGTAATCCTCCAGCCAATAACAAT
>probe:Drosophila_2:1624408_at:222:259; Interrogation_Position=2806; Antisense; CACATCCTGTGTGTAGTCTCAAGAT
>probe:Drosophila_2:1624408_at:536:163; Interrogation_Position=2868; Antisense; AAATCGTGTCATTGTCTCTTAAACA
>probe:Drosophila_2:1624408_at:107:245; Interrogation_Position=3095; Antisense; AATTAGGATTCCTGTCAGCCCAGTT
>probe:Drosophila_2:1624408_at:45:495; Interrogation_Position=3108; Antisense; GTCAGCCCAGTTTAAGCATTTGTGA
>probe:Drosophila_2:1624408_at:521:249; Interrogation_Position=3134; Antisense; CAATTTACGTACTAGGGCCGTCTCG
>probe:Drosophila_2:1624408_at:314:679; Interrogation_Position=3146; Antisense; TAGGGCCGTCTCGAAATCAAACAGA
>probe:Drosophila_2:1624408_at:177:265; Interrogation_Position=3167; Antisense; CAGAGCGCCAGTAAGCAATAATTTA
>probe:Drosophila_2:1624408_at:286:109; Interrogation_Position=3198; Antisense; AGAAGCACTTTGATGCATGCATGAC

Paste this into a BLAST search page for me
GGTTACCTGGGCATCGGACCGCACTGGACCGCACTCGATCGTAATCGAATGTATCGACGCATGAAGCGCTTCCAAGCTTCCAACGGAGAGCGCGTACTTGAGAGCGCGTACTTGCGCGTAATCCTGCGTAATCCTCCAGCCAATAACAATCACATCCTGTGTGTAGTCTCAAGATAAATCGTGTCATTGTCTCTTAAACAAATTAGGATTCCTGTCAGCCCAGTTGTCAGCCCAGTTTAAGCATTTGTGACAATTTACGTACTAGGGCCGTCTCGTAGGGCCGTCTCGAAATCAAACAGACAGAGCGCCAGTAAGCAATAATTTAAGAAGCACTTTGATGCATGCATGAC

Full Affymetrix probeset data:

Annotations for 1624408_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime