Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624409_a_at:

>probe:Drosophila_2:1624409_a_at:12:283; Interrogation_Position=142; Antisense; CTCCTGCTCGATTAGTCAGGTGCGG
>probe:Drosophila_2:1624409_a_at:508:511; Interrogation_Position=167; Antisense; GTGACGCCCTGTCCGGAAGCCAATG
>probe:Drosophila_2:1624409_a_at:79:235; Interrogation_Position=194; Antisense; AATGCCGCATGCCACATTCGCCGGA
>probe:Drosophila_2:1624409_a_at:249:549; Interrogation_Position=216; Antisense; GGAGGCACCGCTTCACGATGAGCTT
>probe:Drosophila_2:1624409_a_at:465:619; Interrogation_Position=321; Antisense; TGCTTACCATGGACCAGGAGGCCTG
>probe:Drosophila_2:1624409_a_at:310:615; Interrogation_Position=372; Antisense; TGAAGGATCCGGTTTCCCAGAAACG
>probe:Drosophila_2:1624409_a_at:180:479; Interrogation_Position=383; Antisense; GTTTCCCAGAAACGTTGCTGCTTCA
>probe:Drosophila_2:1624409_a_at:233:635; Interrogation_Position=411; Antisense; TCGACATCAAGGTGGTGCGCTAGCA
>probe:Drosophila_2:1624409_a_at:418:623; Interrogation_Position=426; Antisense; TGCGCTAGCAAGGTGCACTCCGTAA
>probe:Drosophila_2:1624409_a_at:282:535; Interrogation_Position=437; Antisense; GGTGCACTCCGTAATGGATGCTCCA
>probe:Drosophila_2:1624409_a_at:358:511; Interrogation_Position=508; Antisense; GTGATTTACAAGTGGGTCGATACGA
>probe:Drosophila_2:1624409_a_at:515:121; Interrogation_Position=553; Antisense; AGCGGCACCTGTTTATAATCTGTAT
>probe:Drosophila_2:1624409_a_at:662:493; Interrogation_Position=583; Antisense; GTAATTGGACTCATTTCACCTTGAA
>probe:Drosophila_2:1624409_a_at:425:233; Interrogation_Position=626; Antisense; AATGCTGCTGATATGAGTGCCAATT

Paste this into a BLAST search page for me
CTCCTGCTCGATTAGTCAGGTGCGGGTGACGCCCTGTCCGGAAGCCAATGAATGCCGCATGCCACATTCGCCGGAGGAGGCACCGCTTCACGATGAGCTTTGCTTACCATGGACCAGGAGGCCTGTGAAGGATCCGGTTTCCCAGAAACGGTTTCCCAGAAACGTTGCTGCTTCATCGACATCAAGGTGGTGCGCTAGCATGCGCTAGCAAGGTGCACTCCGTAAGGTGCACTCCGTAATGGATGCTCCAGTGATTTACAAGTGGGTCGATACGAAGCGGCACCTGTTTATAATCTGTATGTAATTGGACTCATTTCACCTTGAAAATGCTGCTGATATGAGTGCCAATT

Full Affymetrix probeset data:

Annotations for 1624409_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime