Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624410_at:

>probe:Drosophila_2:1624410_at:608:235; Interrogation_Position=1063; Antisense; AATCGAACGATCCATTCGCCAACAT
>probe:Drosophila_2:1624410_at:33:191; Interrogation_Position=1083; Antisense; AACATTCGCCAGTTGCCAGACGACA
>probe:Drosophila_2:1624410_at:262:265; Interrogation_Position=1099; Antisense; CAGACGACACTGCAGTTTGCCGAAA
>probe:Drosophila_2:1624410_at:160:177; Interrogation_Position=1121; Antisense; AAACGCGCAGCTTCTGGCTCTTTGG
>probe:Drosophila_2:1624410_at:342:331; Interrogation_Position=1160; Antisense; GCGGAGTTTGTTTTGTGCTTTTAAT
>probe:Drosophila_2:1624410_at:67:249; Interrogation_Position=1182; Antisense; AATTGTCATCTTCTGCGTGATACAC
>probe:Drosophila_2:1624410_at:645:367; Interrogation_Position=1239; Antisense; GAATGCCCAGAAGCGAAAGCCGTTT
>probe:Drosophila_2:1624410_at:116:175; Interrogation_Position=1254; Antisense; AAAGCCGTTTGTGATCTCGCCCAGA
>probe:Drosophila_2:1624410_at:279:75; Interrogation_Position=1304; Antisense; AGGACGAGCCTCTGCACTGTGATAT
>probe:Drosophila_2:1624410_at:523:505; Interrogation_Position=1388; Antisense; GTGCCAGTTATTTATTACCTACCAT
>probe:Drosophila_2:1624410_at:484:669; Interrogation_Position=1414; Antisense; TATGCGTTAGTTTAGCCTTAGGACA
>probe:Drosophila_2:1624410_at:168:555; Interrogation_Position=1434; Antisense; GGACAACCGTCTACCTAGCAAACTG
>probe:Drosophila_2:1624410_at:187:111; Interrogation_Position=1450; Antisense; AGCAAACTGCCTTGAATCCTTTACC
>probe:Drosophila_2:1624410_at:601:689; Interrogation_Position=1523; Antisense; TATTGCCTTGCTCAAAAGCCATCGC

Paste this into a BLAST search page for me
AATCGAACGATCCATTCGCCAACATAACATTCGCCAGTTGCCAGACGACACAGACGACACTGCAGTTTGCCGAAAAAACGCGCAGCTTCTGGCTCTTTGGGCGGAGTTTGTTTTGTGCTTTTAATAATTGTCATCTTCTGCGTGATACACGAATGCCCAGAAGCGAAAGCCGTTTAAAGCCGTTTGTGATCTCGCCCAGAAGGACGAGCCTCTGCACTGTGATATGTGCCAGTTATTTATTACCTACCATTATGCGTTAGTTTAGCCTTAGGACAGGACAACCGTCTACCTAGCAAACTGAGCAAACTGCCTTGAATCCTTTACCTATTGCCTTGCTCAAAAGCCATCGC

Full Affymetrix probeset data:

Annotations for 1624410_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime