Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624411_at:

>probe:Drosophila_2:1624411_at:125:213; Interrogation_Position=10005; Antisense; AAGACCCTGGGCGAGATTTCCTGGG
>probe:Drosophila_2:1624411_at:712:15; Interrogation_Position=10020; Antisense; ATTTCCTGGGACTCCGTTTCACAGA
>probe:Drosophila_2:1624411_at:653:261; Interrogation_Position=10052; Antisense; CACCTCTGGCTATCGGGACAACAAC
>probe:Drosophila_2:1624411_at:342:187; Interrogation_Position=10071; Antisense; AACAACAGCCTGCAGACTGGCCTGC
>probe:Drosophila_2:1624411_at:122:65; Interrogation_Position=10105; Antisense; ATGGATCCTTGGGTGGGTTGACCCT
>probe:Drosophila_2:1624411_at:675:351; Interrogation_Position=10145; Antisense; GCAGCACTCGCTATTAATGGTCTTC
>probe:Drosophila_2:1624411_at:533:651; Interrogation_Position=10159; Antisense; TAATGGTCTTCGAGGGACAGGACGA
>probe:Drosophila_2:1624411_at:534:155; Interrogation_Position=9673; Antisense; ACACGACGACCAGCGAGAGCCAGAG
>probe:Drosophila_2:1624411_at:556:597; Interrogation_Position=9730; Antisense; TGTCGTTGCAGCAGGCTCCCTTCAA
>probe:Drosophila_2:1624411_at:276:623; Interrogation_Position=9772; Antisense; TGCGCTTCGTTTCGTCCGTGGAGTT
>probe:Drosophila_2:1624411_at:389:457; Interrogation_Position=9855; Antisense; GATAGTTCCGGCGATCATACCCGCT
>probe:Drosophila_2:1624411_at:256:575; Interrogation_Position=9899; Antisense; GGCCGCCAGCCGAAAGACCTTTAGA
>probe:Drosophila_2:1624411_at:237:675; Interrogation_Position=9920; Antisense; TAGACTTAAGCGCAGTCGCCTGACG
>probe:Drosophila_2:1624411_at:298:117; Interrogation_Position=9960; Antisense; AGCATTGTCACCTCGCAGGAGGAGC

Paste this into a BLAST search page for me
AAGACCCTGGGCGAGATTTCCTGGGATTTCCTGGGACTCCGTTTCACAGACACCTCTGGCTATCGGGACAACAACAACAACAGCCTGCAGACTGGCCTGCATGGATCCTTGGGTGGGTTGACCCTGCAGCACTCGCTATTAATGGTCTTCTAATGGTCTTCGAGGGACAGGACGAACACGACGACCAGCGAGAGCCAGAGTGTCGTTGCAGCAGGCTCCCTTCAATGCGCTTCGTTTCGTCCGTGGAGTTGATAGTTCCGGCGATCATACCCGCTGGCCGCCAGCCGAAAGACCTTTAGATAGACTTAAGCGCAGTCGCCTGACGAGCATTGTCACCTCGCAGGAGGAGC

Full Affymetrix probeset data:

Annotations for 1624411_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime