Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624412_at:

>probe:Drosophila_2:1624412_at:346:413; Interrogation_Position=3534; Antisense; GACCGATTGTTCCTATGAGAGCTAT
>probe:Drosophila_2:1624412_at:75:425; Interrogation_Position=3550; Antisense; GAGAGCTATAGGTTTTACCATATGT
>probe:Drosophila_2:1624412_at:511:681; Interrogation_Position=3576; Antisense; TATGCATGCATTACTTCAGCTCCAT
>probe:Drosophila_2:1624412_at:305:649; Interrogation_Position=3591; Antisense; TCAGCTCCATCTCTTTTTGATTCAT
>probe:Drosophila_2:1624412_at:109:151; Interrogation_Position=3640; Antisense; ACATTTTGTGGCGTATATAGTTCAA
>probe:Drosophila_2:1624412_at:434:699; Interrogation_Position=3675; Antisense; TTAGAGTACGGTGCCCAAGACGCGC
>probe:Drosophila_2:1624412_at:208:319; Interrogation_Position=3687; Antisense; GCCCAAGACGCGCTTTAAAAATATT
>probe:Drosophila_2:1624412_at:345:373; Interrogation_Position=3729; Antisense; GAAGTCCCATATGTATAATTGTCTA
>probe:Drosophila_2:1624412_at:106:663; Interrogation_Position=3791; Antisense; TAAAGAGCTCTCAACAATATGTATG
>probe:Drosophila_2:1624412_at:30:377; Interrogation_Position=3815; Antisense; GAAGAAATCTGCGTATATCAACATA
>probe:Drosophila_2:1624412_at:569:51; Interrogation_Position=3847; Antisense; ATGCTGATGCATTCGTATTATTATA
>probe:Drosophila_2:1624412_at:708:667; Interrogation_Position=3977; Antisense; TAGCTTCGCTCAAGCATACGACCAG
>probe:Drosophila_2:1624412_at:437:295; Interrogation_Position=3995; Antisense; CGACCAGGTTCGTAAGCTATTAATA
>probe:Drosophila_2:1624412_at:400:175; Interrogation_Position=4048; Antisense; AACACTGGAAGATTTGTACTTACAA

Paste this into a BLAST search page for me
GACCGATTGTTCCTATGAGAGCTATGAGAGCTATAGGTTTTACCATATGTTATGCATGCATTACTTCAGCTCCATTCAGCTCCATCTCTTTTTGATTCATACATTTTGTGGCGTATATAGTTCAATTAGAGTACGGTGCCCAAGACGCGCGCCCAAGACGCGCTTTAAAAATATTGAAGTCCCATATGTATAATTGTCTATAAAGAGCTCTCAACAATATGTATGGAAGAAATCTGCGTATATCAACATAATGCTGATGCATTCGTATTATTATATAGCTTCGCTCAAGCATACGACCAGCGACCAGGTTCGTAAGCTATTAATAAACACTGGAAGATTTGTACTTACAA

Full Affymetrix probeset data:

Annotations for 1624412_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime