FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624414_at:

>probe:Drosophila_2:1624414_at:5:187; Interrogation_Position=239; Antisense; AACAACTGTACGTGGCTGGTGGCGC
>probe:Drosophila_2:1624414_at:674:411; Interrogation_Position=288; Antisense; GACCCGCTTCTTCGTCGTGGAAAGA
>probe:Drosophila_2:1624414_at:297:99; Interrogation_Position=313; Antisense; AGATGGCATCCCCAGTTTAGGGTGC
>probe:Drosophila_2:1624414_at:142:269; Interrogation_Position=351; Antisense; CATTGCCGTGTTGAGGATTTACCCC
>probe:Drosophila_2:1624414_at:221:163; Interrogation_Position=376; Antisense; AAATTCCCGCTCGACGATGTGCGAT
>probe:Drosophila_2:1624414_at:129:181; Interrogation_Position=495; Antisense; AAAACTCCAGGAGATGCCCTTCTTG
>probe:Drosophila_2:1624414_at:420:49; Interrogation_Position=508; Antisense; ATGCCCTTCTTGACCATGGAGAACG
>probe:Drosophila_2:1624414_at:725:57; Interrogation_Position=533; Antisense; ATGAGTGCCAGCAAAGCCATCGCTT
>probe:Drosophila_2:1624414_at:521:201; Interrogation_Position=569; Antisense; AACCGCTTGACATCTGTGCGATGCA
>probe:Drosophila_2:1624414_at:161:95; Interrogation_Position=624; Antisense; AGATTCTGGAGCTCCCTTGATGAAT
>probe:Drosophila_2:1624414_at:70:371; Interrogation_Position=660; Antisense; GAAGCTGTACGGATTACTTTCCTAC
>probe:Drosophila_2:1624414_at:346:675; Interrogation_Position=677; Antisense; TTTCCTACGGTCGAAAAGCCTGCAC
>probe:Drosophila_2:1624414_at:350:199; Interrogation_Position=733; Antisense; AACGCATACTCCAGCTGGATTCAGG
>probe:Drosophila_2:1624414_at:169:369; Interrogation_Position=757; Antisense; GAATCCATGGACTCTATGGCTGCGA

Paste this into a BLAST search page for me
AACAACTGTACGTGGCTGGTGGCGCGACCCGCTTCTTCGTCGTGGAAAGAAGATGGCATCCCCAGTTTAGGGTGCCATTGCCGTGTTGAGGATTTACCCCAAATTCCCGCTCGACGATGTGCGATAAAACTCCAGGAGATGCCCTTCTTGATGCCCTTCTTGACCATGGAGAACGATGAGTGCCAGCAAAGCCATCGCTTAACCGCTTGACATCTGTGCGATGCAAGATTCTGGAGCTCCCTTGATGAATGAAGCTGTACGGATTACTTTCCTACTTTCCTACGGTCGAAAAGCCTGCACAACGCATACTCCAGCTGGATTCAGGGAATCCATGGACTCTATGGCTGCGA

Full Affymetrix probeset data:

Annotations for 1624414_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720