FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624420_at:

>probe:Drosophila_2:1624420_at:699:507; Interrogation_Position=481; Antisense; GTGCTTACGGCTCCAACTATCTGGA
>probe:Drosophila_2:1624420_at:701:585; Interrogation_Position=502; Antisense; TGGAGACGGTATCCTTGCAGCTGCA
>probe:Drosophila_2:1624420_at:510:719; Interrogation_Position=516; Antisense; TTGCAGCTGCATGCCAACGTACGCA
>probe:Drosophila_2:1624420_at:276:577; Interrogation_Position=544; Antisense; GGCGCATCTACTTCGCAGATAAGCT
>probe:Drosophila_2:1624420_at:43:615; Interrogation_Position=581; Antisense; TGAATTGCCCAATGACTACCGTCTG
>probe:Drosophila_2:1624420_at:411:147; Interrogation_Position=595; Antisense; ACTACCGTCTGATGGGCAAGCCGAA
>probe:Drosophila_2:1624420_at:317:377; Interrogation_Position=638; Antisense; GAAGCAGTTCAAGGTGCAGGCCACT
>probe:Drosophila_2:1624420_at:164:503; Interrogation_Position=739; Antisense; GTCCCGCCACGGATCCGATGAGTGA
>probe:Drosophila_2:1624420_at:167:603; Interrogation_Position=800; Antisense; TGTTCCGCAGAAGGTTCCGTCGCCA
>probe:Drosophila_2:1624420_at:339:259; Interrogation_Position=881; Antisense; CACCGAAGAGGCCTACTATTAAGTT
>probe:Drosophila_2:1624420_at:601:687; Interrogation_Position=897; Antisense; TATTAAGTTACGTTGCACAGTTGCT
>probe:Drosophila_2:1624420_at:93:355; Interrogation_Position=911; Antisense; GCACAGTTGCTTGTTTTTATCGTTC
>probe:Drosophila_2:1624420_at:175:705; Interrogation_Position=927; Antisense; TTATCGTTCTGTTGACACGCGACTG
>probe:Drosophila_2:1624420_at:651:259; Interrogation_Position=942; Antisense; CACGCGACTGGGAGTGGCACATAGT

Paste this into a BLAST search page for me
GTGCTTACGGCTCCAACTATCTGGATGGAGACGGTATCCTTGCAGCTGCATTGCAGCTGCATGCCAACGTACGCAGGCGCATCTACTTCGCAGATAAGCTTGAATTGCCCAATGACTACCGTCTGACTACCGTCTGATGGGCAAGCCGAAGAAGCAGTTCAAGGTGCAGGCCACTGTCCCGCCACGGATCCGATGAGTGATGTTCCGCAGAAGGTTCCGTCGCCACACCGAAGAGGCCTACTATTAAGTTTATTAAGTTACGTTGCACAGTTGCTGCACAGTTGCTTGTTTTTATCGTTCTTATCGTTCTGTTGACACGCGACTGCACGCGACTGGGAGTGGCACATAGT

Full Affymetrix probeset data:

Annotations for 1624420_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720